Occurrence record: BIN004

EnvironmentalDNA of Acanthurus recorded on 2017-10-07

Dataset

Data resource Maximising fish detection with eDNA metabarcoding
Occurrence ID BIN004
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 3.0 (Au)
Associated references http://dx.doi.org/10.1002/edn3.75
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2017-10-07
Date precision Day

Taxonomy

Scientific name Acanthurus
Taxon rank Genus
Taxonomic issue Matched to homonym
Name match metric No match
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Western Australia
Locality Browse Island North
Latitude -14.10443
Longitude 123.54690
Geodetic datum EPSG:4326
Coordinate precision Unknown
Coordinate uncertainty in meters 10.0
Verbatim depth Surface
Biome Marine
Verbatim elevation Sea level

Additional properties

chimeracheck VSEARCH
environment(biome) Ocean
environment(feature) Intertidal zone
environment(material) Seawater
experimental factor Fishes, diversity, water sample volume
geographiclocation(countryand/orsea,region) Australia, Browse Island
investigationtype Eukaryote
libraryconstructionmethod Illumina single-end sequencing
nucleicacidextraction Qiagen Dneasy Blood & Tissue Kit
pcrconditions initial denaturation at 95�C for 5 min, followed by 40 cycles of 30 s at 95�C, 30 s at the primer annealing temperature 54�C, and 45 s at 72�C, with a final extension for 10 min at 72�C
pcrprimers 16S rDNA region (16SF/D 5? GACCCTATGGAGCTTTAGAC 3? and 16S2R - degenerate 5? CGCTGTTATCCCTADRGTAACT 3?; Berry et al. 2017, Deagle et al. 2009
primers 16S Fish
projectname Maximising fish detection with eDNA metabarcoding
reads 11735
samplecollectiondevice Bottle
samplematerialprocessing Filtering seawater
samplesize 20700mL
sequence ACCAAAGCAGACCATGTTAATCACCCCTGAACAAAGGACTAAACAATATTGAACCCTGCCCTAATGTCTTCGGTTGGGGCGACCACGGAGAAGTAAAAAAACCCCCGCGTGGAACAGGGATACTATCCCCACAATCACGAGCTCCCGCTCTATTAAACAGAACCTCTGACCAACCAGATCCGGCAACGCCGATCAACGGACCA
sequencingmethod Illumina sequencing by synthesis
data type comment You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/
original scientific name Acanthurus sp.1

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Homonym issues with supplied name Failed
    Depth value non-numeric Failed
    Altitude value non-numeric Failed
    Geodetic datum assumed WGS84 Warning
    Country inferred from coordinates Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Invalid scientific name Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Coordinate uncertainty not valid Passed
    Coordinate uncertainty not specified Passed
    Location not supplied Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 11 missing properties
    Show/Hide 49 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Kimberley Coast
    Australian Tropical Savanna Australian Tropical Savanna
    CAPAD 2010 Terrestrial Browse Island
    CAPAD 2012 Terrestrial Browse Island
    CAPAD 2014 Terrestrial Browse Island
    Biodiversity
    IMCRA 4 Regions Northwest Shelf Province
    IMCRA Meso-scale Bioregions Northwest Shelf
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with plant growth determined by moisture availability
    Marine
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Pinnacle
    Global Seagrass Species Richness (2003) 3.00000000
    Marine Ecoregions of the World Exmouth to Broome
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    Local Government Areas PSMA 2018 SHIRE OF WYNDHAM-EAST KIMBERLEY
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.0
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.0344948
    Endemism (Non-marine) 0.08889023
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Occurrence Density 789.0 frequency
    Shannon Diversity (H) 5.654926 index
    Species Richness 407.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 138579.42 m
    Marspec Distance to Shore 153.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.104073 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.65999997 100 x psu
    Marspec Annual Range in Sea Surface Temperature 3.58 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 3.9299998 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 1.3434 10,000 x degrees C
    Marspec Bathymetric Slope 0.8 10 x degrees
    Marspec Concavity 0.009000001 1000 x degrees
    Marspec East/West Aspect 0.56 radians
    Marspec Maximum Monthly Sea Surface Salinity 34.98 100 x psu
    Marspec Mean Annual Sea Surface Salinity 34.64 100 x psu
    Marspec Mean Annual Sea Surface Temperature 28.279999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.32 100 x psu
    Marspec North/South Aspect 0.83 1 x radians
    Marspec Plan Curvature 0.0 x 10000
    Marspec Profile Curvature -9.0E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 26.21 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 29.789999 100 x degrees C
    Sea Surface Temperature - MODIS Terra 28.664558 Degrees C
    SeaWIFS K490 Mean 0.040480793 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.1868284 mg/m^3
    Topography
    Averaged Topographic Relief 207.04167 metres
    Bathymetry and Topography 9 sec -77.0 m
    Topographic Slope (degrees) 6.0140295 degrees