Occurrence record:

EnvironmentalDNA of Glomeromycota recorded on 2014-12-17

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07488657
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-12-17
Date precision Day

Taxonomy

Scientific name Glomeromycota
Taxon rank phylum
Kingdom Fungi
Phylum Glomeromycota
Class Glomeromycota unclassified
Order Glomeromycota unclassified
Family Glomeromycota unclassified
Genus Glomeromycota unclassified
Species Glomeromycota unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province South Australia
Locality Onkaparinga (C)
Locality Mount bold
Latitude -35.097408
Longitude 138.67071
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 269.0

Additional properties

ammonium nitrogen mg kg 4.0
amplicon ITS1FITS4_fungi
australian soil classification Chromosols
boron hot cacl2 mg kg 0.48
broad land use Conservation and Natural Environments
clay 15.95
color BRWH
conductivity dsm ds m 0.021
course sand 17.05
depth m 20.0
detailed land use Conservation and Natural Environments - Managed resource protection - Surface water supply
dtpa copper mg kg 0.68
dtpa iron mg kg 181.24
dtpa manganese mg kg 4.02
dtpa zinc mg kg 0.64
environment Soil
exc aluminium meq 100g 0.644
exc calcium meq 100g 2.06
exc magnesium meq 100g 0.91
exc potassium meq 100g 0.28
exc sodium meq 100g 0.1
fine sand 32.9
general ecological zone Temperate
gravel 5.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07488657
nitrate nitrogen mg kg 2.0
otu TCGATTTCTGCGCGAATTTTTTTCGCGCGCGTATTTAAAACCCACACTTTTGAAAATTTTTTTACATATTTTTTTACTTGTAATAAGTAATAATTAAAAAGA
otucount 1
organic carbon 1.84
ph level cacl2 cacl2 4.4
ph level h2o h2o 5.6
phosphorus colwell mg kg 4.0
potassium colwell mg kg 239.0
sample id 102.100.100/19296
sample type Soil
sand 49.95
silt 34.1
slope 15.0
soil moisture 2.47
sulphur mg kg 2.5
texture 2.0
vegetation type Woodland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    Irrigation practice - dominant No irrigation
    Land use Modified pastures
    NRM Regions 2010 Adelaide and Mount Lofty Ranges
    NRM Regions 2014 Adelaide and Mount Lofty Ranges
    NRM Regions 2015 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 (Qld 2019) Adelaide and Mount Lofty Ranges
    Stubble practice - dominant (area) Stubble removed
    Stubble practice - dominant (number) Stubble removed
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Adelaide and Mount Lofty Ranges
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions Flinders Lofty Block
    IBRA 6 Sub Regions Mount Lofty Ranges
    IBRA 7 Regions Flinders Lofty Block
    IBRA 7 Subregions Mount Lofty Ranges
    Terrestrial Ecoregional Boundaries Tirari-Sturt Stony Desert
    World Anthropogenic Biomes (2000) Populated woodlands
    Climate
    Agroclimatic classification of Australia Classic "Mediterranean" climate with peaks of growth in winter and spring and moderate growth in winter
    Koppen Climate Classification (All Classes) Temperate: distinctly dry (and warm) summer
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 South Australian Gulf
    Drainage Divisions Level 2 ONKAPARINGA RIVER
    River Regions ONKAPARINGA RIVER
    Marine
    Marine Ecoregions of the World South Australian Gulfs
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Mayo
    Local Government Areas 2011 Onkaparinga (C)
    Local Government Areas 2012 deprecated Onkaparinga - Hills
    Local Government Areas PSMA 2018 CITY OF ONKAPARINGA
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 86
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 2589
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER ADELAIDE
    PSMA ABS SA2 Statistical Areas (2016) CLARENDON
    PSMA ABS SA3 Statistical Areas (2016) ONKAPARINGA
    PSMA ABS SA4 Statistical Areas (2016) ADELAIDE - SOUTH
    PSMA Commonwealth Electoral Boundaries (2016) MAYO
    PSMA Commonwealth Electoral Boundaries (2018) MAYO
    PSMA Indigenous Areas (2016) ONKAPARINGA
    PSMA Indigenous Locations (2016) ONKAPARINGA - SOUTH
    PSMA Indigenous Regions (2016) ADELAIDE
    PSMA Localities (2018) NOARLUNGA
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    PSMA Wards (2018) THALASSA WARD
    Statistical Local Areas Onkaparinga (C) - Hills
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Adelaide Region
    Surface Geology of Australia Nsb
    Topography
    Physiographic Provinces of Australia Gulfs Ranges Province
    Physiographic Regions 2011 Flinders-Lofty Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Eucalypt open forests
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 50733.0 dse
    Dairy numbers 6716.0 dse
    Natural resource management expenditure 7775071.0 $
    Natural resource management expenditure - additional 1.0 $/ha
    Sheep numbers 8020.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.4172
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.2024
    Endemism 0.02933973
    Endemism (Non-marine) 0.032818727
    Mammals – Fritz et al 2009 - 0.5 degree 0.4126
    Migratory species (2008) 3.0 frequency
    Occurrence Density 134025.0 frequency
    Shannon Diversity (H) 6.167065 index
    Species Richness 4350.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 11.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.61571586
    2030A1BMk35M: Aridity index - month max 1.8071508
    2030A1BMk35M: Aridity index - month min 0.06474044
    2030A1BMk35M: Evaporation - annual mean 141.98291 mm
    2030A1BMk35M: Evaporation - month max 250.23 mm
    2030A1BMk35M: Evaporation - month min 53.98 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.06 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.32 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.04 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 71.32373 %
    2030A1BMk35M: Humidity - month max relative 3pm 83.49202 %
    2030A1BMk35M: Humidity - month min relative 3pm 59.49897 %
    2030A1BMk35M: Precipitation - annual mean 53.410835 mm
    2030A1BMk35M: Precipitation - driest month 16.2 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1156132
    2030A1BMk35M: Precipitation - max difference between successive months 0.96102154 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.5736452 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.22889465
    2030A1BMk35M: Precipitation - spring or autumn season 0.114828624
    2030A1BMk35M: Precipitation - summer or winter season -3.3151014
    2030A1BMk35M: Precipitation - wettest month 97.55 mm
    2030A1BMk35M: Precipitation deficit - annual mean -88.57208 mm
    2030A1BMk35M: Precipitation deficit - month max -234.03 mm
    2030A1BMk35M: Precipitation deficit - month min 43.570004 mm
    2030A1BMk35M: Radiation - max month precipitation modified 27.47 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 17.030834 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 6.98 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 21.346666 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.269167 degrees C
    2030A1BMk35M: Temperature - annual range 21.24002 degrees C
    2030A1BMk35M: Temperature - coldest month min 7.31 degrees C
    2030A1BMk35M: Temperature - coolest month max 14.4 degrees C
    2030A1BMk35M: Temperature - max difference in max 3.0299988 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.9599915 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 13.0 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 10.077502 degrees C
    2030A1BMk35M: Temperature - min difference in max -3.7600098 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.9700012 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 6.980011 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 28.55 degrees C
    2030A1BMk35M: Temperature - warmest month min 15.55 degrees C
    Aridity index - annual mean 0.80973107
    Aridity index - month max 2.1859298
    Aridity index - month min 0.106431246
    Evaporation - annual mean 126.502235 (ml/5km x 5km pixel)
    Evaporation - average 17905.0 ml
    Evaporation - month max 235.17859 mm
    Evaporation - month min 43.684853 mm
    Evaporation - variability 6.0 %
    Growth index C3 macrotherm plants - annual mean 0.05 index
    Growth index C3 mesotherm plants - annual mean 0.3 index
    Growth index C4 megatherm plants - annual mean 0.03 index
    Humidity - annual mean relative 78.31255 %
    Humidity - annual mean relative 3pm 70.774185 %
    Humidity - month max relative 90.135544 %
    Humidity - month max relative 3pm 82.96488 %
    Humidity - month min relative 59.00751 %
    Humidity - month min relative 3pm 59.00751 %
    Precipitation - annual 779.0 mm
    Precipitation - annual (Bio12) 726.0 mm
    Precipitation - annual (log) seasonality index -0.16178302
    Precipitation - annual mean 59.858604 mm
    Precipitation - annual seasonality -1.3807418
    Precipitation - annual seasonality ratio 0.41889152
    Precipitation - autumn 178.0 mm
    Precipitation - autumn reliability 41.0 %
    Precipitation - coldest quarter (Bio19) 309.0 mm
    Precipitation - driest month 25.03035 mm
    Precipitation - driest period (Bio14) 4.0 mm
    Precipitation - driest quarter (Bio17) 72.0 mm
    Precipitation - equinox seasonality ratio 1.0054272
    Precipitation - max difference between successive months 1.0653911 mm/day
    Precipitation - min difference between successive months -0.63646287 mm/day
    Precipitation - seasonality (Bio15) 52.0 mm
    Precipitation - solstice seasonality ratio 0.30176446
    Precipitation - spring 184.0 mm
    Precipitation - spring or autumn (log) season 0.0010429949
    Precipitation - spring or autumn season 0.005396101
    Precipitation - spring reliability 50.0 %
    Precipitation - summer 87.0 mm
    Precipitation - summer or winter (log) season -0.26645428
    Precipitation - summer or winter season -2.2872562
    Precipitation - summer reliability 27.0 %
    Precipitation - warmest quarter (Bio18) 73.0 mm
    Precipitation - wettest month 104.03035 mm
    Precipitation - wettest period (Bio13) 27.0 mm
    Precipitation - wettest quarter (Bio16) 310.0 mm
    Precipitation - winter 294.0 mm
    Precipitation - winter reliability 71.0 %
    Precipitation deficit - annual mean -66.64363 mm
    Precipitation deficit - month max -210.14824 mm
    Precipitation deficit - month min 56.439457 mm
    Radiation - annual mean (Bio20) 16.8 MJ/m2/day
    Radiation - coldest quarter (Bio27) 8.6 MJ/m2/day
    Radiation - driest quarter (Bio25) 24.8 MJ/m2/day
    Radiation - highest period (Bio21) 27.4 MJ/m2/day
    Radiation - lowest period (Bio22) 6.7 MJ/m2/day
    Radiation - max month precipitation modified 26.8 MJ/m2/day
    Radiation - mean annual precipitation modified 16.815655 MJ/m2/day
    Radiation - min month precipitation modified 7.096965 MJ/m2/day
    Radiation - seasonality (Bio23) 44.0
    Radiation - warmest quarter (Bio26) 25.3 MJ/m2/day
    Radiation - wettest quarter (Bio24) 8.2 MJ/m2/day
    Temperature - annual max mean 19.638332 degrees C
    Temperature - annual mean (Bio01) 15.4 degrees C
    Temperature - annual min mean 9.490833 degrees C
    Temperature - annual range 20.399994 degrees C
    Temperature - annual range (Bio07) 21.5 degrees C
    Temperature - coldest month min 5.56 degrees C
    Temperature - coldest period min (Bio06) 6.4 degrees C
    Temperature - coldest quarter mean (Bio11) 10.6 degrees C
    Temperature - coolest month max 12.84 degrees C
    Temperature - diurnal range mean (Bio02) 9.9 degrees C
    Temperature - driest quarter mean (Bio09) 20.4 degrees C
    Temperature - isothermality (Bio03) 0.46 %
    Temperature - max absolute mean max 43.0 degrees C
    Temperature - max difference in max 2.9299927 degrees C/day
    Temperature - max difference in min 1.8300171 degrees C/day
    Temperature - max month diurnal range 12.789978 degrees C
    Temperature - mean annual absolute mean min 2.15125 degrees C
    Temperature - mean annual diurnal range 10.147499 degrees C
    Temperature - min absolute mean min -1.812 degrees C
    Temperature - min difference in max -3.9400024 degrees C/day
    Temperature - min difference in min -2.269989 degrees C/day
    Temperature - min month diurnal range 7.279999 degrees C
    Temperature - month hottest maximum 26.34 degrees C
    Temperature - month mean absolute max 38.906002 degrees C
    Temperature - seasonality (Bio04) 1.33
    Temperature - warmest month min 13.79 degrees C
    Temperature - warmest period max (Bio05) 27.9 degrees C
    Temperature - warmest quarter (Bio10) 20.4 degrees C
    Temperature - wettest quarter mean (Bio08) 10.6 degrees C
    Vapour pressure deficit - annual mean 0.285159 KPa
    Vapour pressure deficit - annual mean 9am 0.41642714 KPa
    Vapour pressure deficit - month max 0.8056427 KPa
    Vapour pressure deficit - month max 9am 0.8056427 KPa
    Vapour pressure deficit - month min 0.016827464 KPa
    Vapour pressure deficit - month min 9am 0.1395402 KPa
    Wind run - annual mean 269.38364 km/day
    Wind run - month max 303.70126 km/day
    Wind run - month min 208.196 km/day
    Wind speed - annual mean 3pm 5.4416404 m/s
    Wind speed - annual mean 9am 4.0917106 m/s
    Wind speed - annual mean 9am or 3pm 5.3999996 m/s
    Wind speed - month max 3pm 6.0998945 m/s
    Wind speed - month max 9am 4.700105 m/s
    Wind speed - month max 9am or 3pm 6.0998945 m/s
    Wind speed - month min 3pm 4.3 m/s
    Wind speed - month min 9am 3.3 m/s
    Wind speed - month min 9am or 3pm 3.3 m/s
    WorldClim: Precipitation - annual 787.0 mm
    WorldClim: Precipitation - coldest quarter 318.0 mm
    WorldClim: Precipitation - driest month 22.0 mm
    WorldClim: Precipitation - driest quarter 75.0 mm
    WorldClim: Precipitation - seasonality 50.0
    WorldClim: Precipitation - warmest quarter 75.0 mm
    WorldClim: Precipitation - wettest month 117.0 mm
    WorldClim: Precipitation - wettest quarter 320.0 mm
    WorldClim: Temperature - annual mean 149.0 degrees C * 10
    WorldClim: Temperature - annual range 210.0 degrees C * 10
    WorldClim: Temperature - coldest month min 60.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 102.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 104.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 197.0 degrees C * 10
    WorldClim: Temperature - isothermality 49.0 %
    WorldClim: Temperature - seasonality 3734.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 270.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 197.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 110.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.1972308 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.044721358 km
    Euclidean Distance to Coast (metres) 6741.3896 m
    Remoteness index 0.7453484
    Hydrology
    Drainage - average 2880.0 megalitres/5x5km/year
    Drainage - variability 29.0 %
    Runoff - average 2111.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Disadvantaged 1061.9031 points (mean=1000)
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.5205853
    2030A1BMk35M: Crop factor - month max 0.90000004
    2030A1BMk35M: Crop factor - month min 0.06474044
    2030A1BMk35M: Water deficit - month max 131.48091 mm
    2030A1BMk35M: Water deficit - month mean 52.080738 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.0059984 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 46.852676
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 5.82664
    2030A1BMk35M: Water surplus - annual mean 2.277303 mm
    2030A1BMk35M: Water surplus - month max 17.355644 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 75.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.34 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 26.0 %
    Bouguer gravity anomalies -33.49757 Gal
    Bulk density 1.5336363 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.9727504 %
    Carbon store pre-European 95.7883 kgC/ha
    Clay % 21.772728 %
    Crop factor - annual mean 0.5701487
    Crop factor - month max 0.90000004
    Crop factor - month min 0.106431246
    Erodibility 36.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 798.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 166.66667 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 220.0 my
    Lithology - fertility 6.0 index
    Lithology - mean age 740.0 my
    Lithology - mean age (log) 2.8692317 log my
    Lithology - mean age range (log) 2.3424227 log my
    Magnetic anomalies 19.0 nT
    Moisture - average 55.0 %
    Moisture - variability 7.0 %
    Moisture Index - annual mean (Bio28) 0.59
    Moisture Index - coldest quarter mean (Bio35) 0.98
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.08
    Moisture Index - lowest quarter mean (Bio33) 0.11
    Moisture Index - seasonality (Bio31) 64.0
    Moisture Index - warmest quarter mean (Bio34) 0.11
    Nitrogen - plant-available pre-European 8137.722 kgN/ha
    Nitrogen concentration pre-European 60.32986 mgN kg/H2O
    Nitrogen store pre-European 73.1329 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 2.3818183
    Ph - soil 7.0 ph
    Phosphorus - plant-available pre-European 13.45497 kgP/ha
    Phosphorus - plant-available total pre-European 1148.7799 kgP/ha
    Phosphorus pre-European 11.09947 mgP kg/H2O
    Soil depth 0.7 m
    Soil pedality 2.3818183
    Soils - coarse 0.0 class
    Substrate data reliability 3.0
    Topographic wetness index 9.235078
    Unreliable water retention parameters 20.0
    Water deficit - month max 128.57707 mm
    Water deficit - month mean 47.22753 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 34000.0 mm
    Water holding capacity - plant-available 72.0 mm
    Water potential - annual mean -0.8539986 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 51.31338
    Water stress index - month max 81.0
    Water stress index - month min 9.578812
    Water surplus - annual mean 8.57391 mm
    Water surplus - month max 61.198547 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 1.53617 Weathering Intensity Index
    Topography
    Aspect 155.0 degrees
    Averaged Topographic Relief 208.0 metres
    Bathymetry and Topography 9 sec 250.0 m
    Elevation 228.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 4.0913258 degrees
    Topographic relief 41.42986 m
    Topographic roughness 4.912482 %
    Topographic slope (%) 4.053802 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2689 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 44.0 %
    Fractional Cover - Bare Soil (2012-03-05) 8.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 43.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 49.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0209 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.0 m^2 plant / m^2 ground
    NDVI Mean 72.0 NDVI x 100
    NPP Mean 9.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.4818 NDVI
    Phenology peak day of year 2002 dry 240.11111 Day
    Phenology peak day of year 2012 wet 212.55556 Day