We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3629067

GenomicDNA of LEPIDOPTERA | Moths recorded on 1995-03-24

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3629067
Other catalog numbers recordID:1382916;ProcessID:ANICC630-10;sampleID:ANIC Gen No. 003792
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Edwards, E.D.|Mathews, M.
Supplied as "E.D. Edwards & M. Mathews"
Life stage adult
License CC-BY-Int
Field number ANIC Gen No. 003792
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Michael Shaffer

Event

Field number ANIC Gen No. 003792
Occurrence date 1995-03-24
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Cloncurry (S)
Locality 2km N of Burke & Wills Roadhouse
Latitude -19.12
Longitude 140.21
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ546681
markercode COI-5P
nucleotides AACCTTATATTTTATTTTTGGTATTTGATCAGGAATAGTAGGAACTTCTTTAAGACTTTTAATTCGTGCTGAGTTAGGAAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGGTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATCATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGTGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCCCCCTCTCTTACATTACTTATTTCAAGAAGCATTGTAGAAAGTGGAGCTGGTACTGGATGAACAGTTTACCCTCCTTTATCTTCTAATATTGCTCATGGTGGAAGTTCAGTAGACTTAGCAATTTTTTCATTACATTTAGCTGGTATTTCTTCTATTTTAGGTGCAATTAATTTTATTACAACTATTATTAATATAAAATTAAATGGATTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGGATTACAGCTCTTCTTTTATTACTATCTTTACCAGTTCTAGCTGGAGCAATTACAATACTTTTAACAGACCGAAACTTAAATACATCTTTTTTTGATCCTGCTGGAGGGGGTGACCCAATTCTATACCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:42Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Freshwater Central Australian Freshwater
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Irrigation practice - dominant No irrigation
    Land use Grazing of native pastures
    NRM Regions 2010 Southern Gulf
    NRM Regions 2014 Southern Gulf
    NRM Regions 2015 Southern Gulf
    NRM Regions 2017 Southern Gulf
    NRM Regions 2017 (Qld 2019) Southern Gulf
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Southern Gulf
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Gulf Plains
    IBRA 6 Sub Regions Armraynald Plains
    IBRA 7 Regions Gulf Plains
    IBRA 7 Subregions Armraynald Plains
    Terrestrial Ecoregional Boundaries Carpentaria Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Semi-arid, with some growth in the warm season, but too dry for cropping
    Koppen Climate Classification (All Classes) Grassland: hot (winter drought)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Tussock grassland (tropical semi-arid/arid)
    Hydrology
    Drainage Divisions Level 1 Carpentaria Coast
    Drainage Divisions Level 2 NICHOLSON-LEICHHARDT RIVERS
    River Regions NICHOLSON-LEICHHARDT RIVERS
    Marine
    Marine Ecoregions of the World Arnhem Coast to Gulf of Carpenteria
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Kennedy
    Indigenous Land Use Agreements KERG ILUA
    Local Government Areas 2011 Cloncurry (S)
    Local Government Areas 2012 deprecated Cloncurry
    Local Government Areas PSMA 2018 CLONCURRY SHIRE
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Kalkadoon People #4
    Native Title Determinations (13/7/2020) Kalkadoon People #4 QCD2011/007
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 9
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 728
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) MOUNT ISA REGION
    PSMA ABS SA3 Statistical Areas (2016) OUTBACK - NORTH
    PSMA ABS SA4 Statistical Areas (2016) QUEENSLAND - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) KENNEDY
    PSMA Commonwealth Electoral Boundaries (2018) KENNEDY
    PSMA Indigenous Areas (2016) CLONCURRY - MCKINLAY
    PSMA Indigenous Locations (2016) CLONCURRY - MCKINLAY
    PSMA Indigenous Regions (2016) MOUNT ISA
    PSMA Localities (2018) FOUR WAYS
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) MOUNT ISA
    PSMA State Electoral Boundaries (2018) TRAEGER
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Cloncurry (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Carpentaria Lowlands Region
    Surface Geology of Australia Qa
    Topography
    Physiographic Provinces of Australia Carpentaria Lowlands Province
    Physiographic Regions 2011 Armraynald Plain
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Acacia Open Woodlands
    NVIS 4.1 Major Vegetation Subgroups Acacia (+/- low) open woodlands and sparse shrublands +/- tussock grass
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Modified
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 2522075.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.3924
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.9908
    Endemism 0.003940761
    Endemism (Non-marine) 0.003955356
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 3.0 frequency
    Occurrence Density 401.0 frequency
    Shannon Diversity (H) 4.70143 index
    Species Richness 159.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 1.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.17709166
    2030A1BMk35M: Evaporation - month min 171.94 mm
    2030A1BMk35M: Precipitation - annual mean 44.845833 mm
    2030A1BMk35M: Precipitation - driest month 0.37 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.684543
    2030A1BMk35M: Precipitation - spring or autumn season -0.45231047
    2030A1BMk35M: Temperature - annual max mean 34.8975 degrees C
    2030A1BMk35M: Temperature - annual min mean 20.735 degrees C
    2030A1BMk35M: Temperature - annual range 26.25 degrees C
    Aridity index - annual mean 0.18735251
    Aridity index - month max 0.6660201
    Aridity index - month min 0.008677922
    Evaporation - annual mean 247.32356 (ml/5km x 5km pixel)
    Evaporation - average 10515.0 ml
    Evaporation - month max 329.56992 mm
    Evaporation - month min 174.56993 mm
    Evaporation - variability 27.0 %
    Growth index C3 macrotherm plants - annual mean 0.17 index
    Growth index C3 mesotherm plants - annual mean 0.04 index
    Growth index C4 megatherm plants - annual mean 0.17 index
    Humidity - annual mean relative 62.633522 %
    Humidity - annual mean relative 3pm 49.46316 %
    Humidity - month max relative 74.42193 %
    Humidity - month max relative 3pm 58.00555 %
    Humidity - month min relative 43.508587 %
    Humidity - month min relative 3pm 43.508587 %
    Precipitation - annual 546.0 mm
    Precipitation - annual (Bio12) 559.0 mm
    Precipitation - annual mean 45.727768 mm
    Precipitation - annual seasonality 9.972461
    Precipitation - coldest quarter (Bio19) 11.0 mm
    Precipitation - driest month 2.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 8.0 mm
    Precipitation - equinox seasonality ratio 0.5462963
    Precipitation - seasonality (Bio15) 120.0 mm
    Precipitation - spring or autumn season -0.81666666
    Precipitation - warmest quarter (Bio18) 319.0 mm
    Precipitation - wettest month 145.73323 mm
    Precipitation - wettest period (Bio13) 38.0 mm
    Precipitation - wettest quarter (Bio16) 404.0 mm
    Radiation - annual mean (Bio20) 21.5 MJ/m2/day
    Radiation - seasonality (Bio23) 17.0
    Radiation - warmest quarter (Bio26) 24.8 MJ/m2/day
    Temperature - annual max mean 32.755 degrees C
    Temperature - annual mean (Bio01) 26.6 degrees C
    Temperature - annual min mean 18.7075 degrees C
    Temperature - annual range 33.399994 degrees C
    Temperature - annual range (Bio07) 26.6 degrees C
    Temperature - coldest month min 11.2 degrees C
    Temperature - coldest period min (Bio06) 11.5 degrees C
    Temperature - coldest quarter mean (Bio11) 20.6 degrees C
    Temperature - diurnal range mean (Bio02) 14.1 degrees C
    Temperature - driest quarter mean (Bio09) 21.9 degrees C
    Temperature - isothermality (Bio03) 0.53 %
    Temperature - month hottest maximum 37.4 degrees C
    Temperature - seasonality (Bio04) 1.38
    Temperature - warmest month min 24.26 degrees C
    Temperature - warmest period max (Bio05) 38.1 degrees C
    Temperature - warmest quarter (Bio10) 30.9 degrees C
    Temperature - wettest quarter mean (Bio08) 30.6 degrees C
    Wind run - annual mean 164.31186 km/day
    WorldClim: Precipitation - annual 572.0 mm
    WorldClim: Precipitation - coldest quarter 10.0 mm
    WorldClim: Precipitation - driest month 2.0 mm
    WorldClim: Precipitation - driest quarter 9.0 mm
    WorldClim: Precipitation - seasonality 114.0
    WorldClim: Precipitation - warmest quarter 290.0 mm
    WorldClim: Precipitation - wettest month 166.0 mm
    WorldClim: Precipitation - wettest quarter 389.0 mm
    WorldClim: Temperature - annual mean 261.0 degrees C * 10
    WorldClim: Temperature - annual range 254.0 degrees C * 10
    WorldClim: Temperature - coldest month min 122.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 203.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 136.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 218.0 degrees C * 10
    WorldClim: Temperature - isothermality 53.0 %
    WorldClim: Temperature - seasonality 4051.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 376.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 305.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 294.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.070710674 degrees
    Distance - to coast 1.421443 km x 100
    Distance - to non-permanent water (weighted) 0.15297058 degrees
    Distance - to permanent water (weighted) 0.070710674 km
    Euclidean Distance to Coast (metres) 184556.84 m
    Remoteness index 16.853895
    Fire
    Fire - time since last 8.0 years
    Fire frequency 1.0 frequency
    Hydrology
    Drainage - average 95.0 megalitres/5x5km/year
    Drainage - variability 196.0 %
    Runoff - average 2056.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.1 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 60.902668
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 72.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.37 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 51.0 %
    Bulk density 1.288302 Mg/m^3
    Carbon - organic 0.13081701 %
    Clay % 27.462265 %
    Hydrologic conductivity - average saturated 150.0 mm/h
    Moisture Index - annual mean (Bio28) 0.19
    Moisture Index - highest quarter mean (Bio32) 0.55
    Nutrient status 1.15 index
    Soil depth 1.0 m
    Soil pedality 2.0
    Water holding capacity 29000.0 mm
    Water stress index - month max 59.941803
    Weathering Intensity V2 4.06392 Weathering Intensity Index
    Topography
    Aspect 319.0 degrees
    Averaged Topographic Relief 14.5 metres
    Bathymetry and Elvation 9 sec 69.0 m
    Elevation 67.0 m
    Topographic Slope (degrees) 0.036999885 degrees
    Topographic relief 2.563881 m
    Topographic slope (%) 0.1354969 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2708 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 46.0 %
    Fractional Cover - Bare Soil (2012-03-05) 4.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 57.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 39.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0021 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.9 m^2 plant / m^2 ground
    NDVI Mean 34.0 NDVI x 100
    NPP Mean 2.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.4965 NDVI