We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3756123

GenomicDNA of LEPIDOPTERA | Moths recorded on 1988-10-06

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3756123
Other catalog numbers recordID:1652654;ProcessID:ANICK970-10;sampleID:10ANIC-07967
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Edwards, E.D.
Supplied as "E.D.Edwards"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Occurrence date 1988-10-06
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory New South Wales
Locality Unincorporated NSW
Locality Homestd Gorge
Latitude -31.17
Longitude 142.18
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ950985
markercode COI-5P
nucleotides GACATTATATTTTATTTTTGGTATTTGAGCAGGTATAGTAGGAACTTCATTAAGATTATTAATTCGAGCTGAATTAGGAACTCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGTAACTGACTTGTACCTTTAATGTTAGGAGCTCCTGATATAGCATTCCCCCGAATAAATAATATAAGTTTCTGATTACTTCCCCCATCTCTTACTTTATTAATTTCAAGTAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACGGTTTATCCCCCTCTTTCATCTAATATTGCCCATGGAGGTAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCTATTTTAGGGGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAGTTTATCTTTTGATCAAATACCTTTATTTATTTGAGCTGTAGGGATTACTGCATTTTTATTATTACTTTCTCTTCCTGTATTAGCTGGAGCTATTACTATACTTTTAACAGACCGAAATCTTAATACATCTTTTTTTGACCCTGCTGGAGGAGGAGATCCAATTTTATATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No practices
    Fallow practice - dominant (number) No practices
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Irrigation practice - dominant No irrigation
    Land use Grazing of native pastures
    NRM Regions 2010 Western
    NRM Regions 2014 Western
    NRM Regions 2015 Western
    NRM Regions 2017 Western
    NRM Regions 2017 (Qld 2019) Western
    Stubble practice - dominant (area) No practices reported
    Stubble practice - dominant (number) No practices reported
    Tillage practice - dominant (area) Other cultivation
    Tillage practice - dominant (number) Other cultivation
    Area management
    National Landcare Program Management Units 2018 Western
    Biodiversity
    Freshwater Ecoregions of the World Lake Eyre Basin
    IBRA 6 Regions Broken Hill Complex
    IBRA 6 Sub Regions Barrier Range Outwash
    IBRA 7 Regions Broken Hill Complex
    IBRA 7 Subregions Barrier Range Outwash
    Terrestrial Ecoregional Boundaries Tirari-Sturt Stony Desert
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Semi-arid climate that is too dry to support field crops. Soil moisture tends to be greatest in winter
    Koppen Climate Classification (All Classes) Desert: hot (persistently dry)
    Koppen Climate Classification (Major Classes) Desert
    Fire
    Fire regime niches Acacia shrubland (mulga) (semi-arid/arid)
    Hydrology
    Drainage Divisions Level 1 Lake Eyre Basin
    Drainage Divisions Level 2 COOPER CREEK-BULLOO RIVER
    River Regions COOPER CREEK-BULLOO RIVER
    Marine
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Farrer
    Local Government Areas 2011 Unincorporated NSW
    Local Government Areas 2012 deprecated Unincorp. Far West
    Local Government Areas PSMA 2018 UNINCORPORATED FAR WEST
    NSW Local Land Services Regions Western
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 49
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 2255
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) FAR WEST
    PSMA ABS SA3 Statistical Areas (2016) BROKEN HILL AND FAR WEST
    PSMA ABS SA4 Statistical Areas (2016) FAR WEST AND ORANA
    PSMA Commonwealth Electoral Boundaries (2016) PARKES
    PSMA Commonwealth Electoral Boundaries (2018) PARKES
    PSMA Indigenous Areas (2016) FAR WEST
    PSMA Indigenous Locations (2016) BROKEN HILL - SURROUNDS
    PSMA Indigenous Regions (2016) NORTH-WESTERN NSW
    PSMA Localities (2018) MUTAWINTJI
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NSW)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) BARWON
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NSW)
    Statistical Local Areas Unincorp. Far West
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Bancannia Region
    Surface Geology of Australia Qd
    Topography
    Physiographic Provinces of Australia Central Lowlands Province
    Physiographic Regions 2011 Warwick Lowland
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Acacia Shrublands
    NVIS 4.1 Major Vegetation Subgroups Mulga (Acacia aneura) woodlands and shrublands +/- tussock grass +/- forbs
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Modified
    Vegetation types - native Acacia open woodlands
    Vegetation types - present Acacia open woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 3923430.0 $
    Area management
    Phosphorus 0.009643 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8085
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 1.9823
    Endemism 9.2942757E-4
    Endemism (Non-marine) 9.325212E-4
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 2.0 frequency
    Occurrence Density 74.0 frequency
    Shannon Diversity (H) 1.0091535 index
    Species Richness 12.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 5.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.088930495
    2030A1BMk35M: Evaporation - month min 81.21 mm
    2030A1BMk35M: Precipitation - annual mean 17.195 mm
    2030A1BMk35M: Precipitation - driest month 9.79 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0909932
    2030A1BMk35M: Precipitation - spring or autumn season 0.08893911
    2030A1BMk35M: Temperature - annual max mean 27.7375 degrees C
    2030A1BMk35M: Temperature - annual min mean 13.965 degrees C
    2030A1BMk35M: Temperature - annual range 30.360016 degrees C
    Aridity index - annual mean 0.08390332
    Aridity index - month max 0.15154804
    Aridity index - month min 0.04678557
    Evaporation - annual mean 252.81302 (ml/5km x 5km pixel)
    Evaporation - average 5208.0 ml
    Evaporation - month max 436.00702 mm
    Evaporation - month min 97.576584 mm
    Evaporation - variability 28.0 %
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.05 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 69.0541 %
    Humidity - annual mean relative 3pm 53.7788 %
    Humidity - month max relative 86.61036 %
    Humidity - month max relative 3pm 68.84494 %
    Humidity - month min relative 43.389248 %
    Humidity - month min relative 3pm 43.389248 %
    Precipitation - annual 204.0 mm
    Precipitation - annual (Bio12) 226.0 mm
    Precipitation - annual mean 17.565628 mm
    Precipitation - annual seasonality 0.3965924
    Precipitation - coldest quarter (Bio19) 52.0 mm
    Precipitation - driest month 12.0 mm
    Precipitation - driest period (Bio14) 2.0 mm
    Precipitation - driest quarter (Bio17) 45.0 mm
    Precipitation - equinox seasonality ratio 0.9411765
    Precipitation - seasonality (Bio15) 26.0 mm
    Precipitation - spring or autumn season -0.06122449
    Precipitation - warmest quarter (Bio18) 74.0 mm
    Precipitation - wettest month 24.0 mm
    Precipitation - wettest period (Bio13) 7.0 mm
    Precipitation - wettest quarter (Bio16) 74.0 mm
    Radiation - annual mean (Bio20) 20.0 MJ/m2/day
    Radiation - seasonality (Bio23) 33.0
    Radiation - warmest quarter (Bio26) 27.2 MJ/m2/day
    Temperature - annual max mean 25.571667 degrees C
    Temperature - annual mean (Bio01) 19.5 degrees C
    Temperature - annual min mean 10.984167 degrees C
    Temperature - annual range 30.200012 degrees C
    Temperature - annual range (Bio07) 30.7 degrees C
    Temperature - coldest month min 3.61 degrees C
    Temperature - coldest period min (Bio06) 4.6 degrees C
    Temperature - coldest quarter mean (Bio11) 11.8 degrees C
    Temperature - diurnal range mean (Bio02) 13.7 degrees C
    Temperature - driest quarter mean (Bio09) 20.9 degrees C
    Temperature - isothermality (Bio03) 0.45 %
    Temperature - month hottest maximum 34.22 degrees C
    Temperature - seasonality (Bio04) 2.06
    Temperature - warmest month min 18.47 degrees C
    Temperature - warmest period max (Bio05) 35.3 degrees C
    Temperature - warmest quarter (Bio10) 27.2 degrees C
    Temperature - wettest quarter mean (Bio08) 27.1 degrees C
    Wind run - annual mean 235.61163 km/day
    WorldClim: Precipitation - annual 249.0 mm
    WorldClim: Precipitation - coldest quarter 52.0 mm
    WorldClim: Precipitation - driest month 15.0 mm
    WorldClim: Precipitation - driest quarter 52.0 mm
    WorldClim: Precipitation - seasonality 22.0
    WorldClim: Precipitation - warmest quarter 78.0 mm
    WorldClim: Precipitation - wettest month 32.0 mm
    WorldClim: Precipitation - wettest quarter 80.0 mm
    WorldClim: Temperature - annual mean 188.0 degrees C * 10
    WorldClim: Temperature - annual range 300.0 degrees C * 10
    WorldClim: Temperature - coldest month min 42.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 112.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 135.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 112.0 degrees C * 10
    WorldClim: Temperature - isothermality 45.0 %
    WorldClim: Temperature - seasonality 5898.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 342.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 263.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 258.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.20124611 degrees
    Distance - to coast 4.555436 km x 100
    Distance - to non-permanent water (weighted) 0.20124611 degrees
    Distance - to permanent water (weighted) 0.71700764 km
    Euclidean Distance to Coast (metres) 468485.0 m
    Remoteness index 10.491924
    Hydrology
    Drainage - average 0.0 megalitres/5x5km/year
    Drainage - variability 202.0 %
    Runoff - average 130.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.0 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 16.121725
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 144.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.4 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 27.0 %
    Bulk density 1.2731578 Mg/m^3
    Carbon - organic 0.2242858 %
    Clay % 28.460526 %
    Hydrologic conductivity - average saturated 79.09091 mm/h
    Moisture Index - annual mean (Bio28) 0.09
    Moisture Index - highest quarter mean (Bio32) 0.17
    Nutrient status 1.35 index
    Soil depth 0.9 m
    Soil pedality 1.9326316
    Water holding capacity 29000.0 mm
    Water stress index - month max 13.639324
    Weathering Intensity V2 5.36913 Weathering Intensity Index
    Topography
    Aspect 260.0 degrees
    Averaged Topographic Relief 49.458332 metres
    Bathymetry and Elvation 9 sec 161.0 m
    Elevation 170.0 m
    Topographic Slope (degrees) 0.22881244 degrees
    Topographic relief 9.564209 m
    Topographic slope (%) 0.7062795 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1741 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 16.0 %
    Fractional Cover - Bare Soil (2012-03-05) 72.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 18.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 10.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0093 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.2 m^2 plant / m^2 ground
    NDVI Mean 21.0 NDVI x 100
    NPP Mean 1.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3226 NDVI