Occurrence record: BOLD - Australian records - 2727525

Material Sample of Echinorhinus cookei Pietschmann, 1928 | Prickley Shark recorded on 2003-03-01
   API

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 2727525
Other catalog numbers ["recordID:295402;ProcessID:FOAE603-06;sampleID:BW-A2815"]
Record type Material Sample
Supplied basis "MaterialSample"
Preparations nullnull
Collector Williams, Warren  
Supplied as "Warren Williams"
Associated Occurrence Status Representative record
Associated occurrences This record has 1 inferred associated occurrences
For more information see Inferred associated occurrence details
License CC-BY-Int
Presence/Absence PRESENT
Associated records REPRESENTATIVE

Event

Field Number GT13
Occurrence date 2003-03-01
Date precision DAY

Taxonomy

Scientific name Echinorhinus cookei
Identified to rank species
Common name Prickley Shark
Kingdom Animalia
Phylum Chordata
Class Chondrichthyes
Order Squaliformes
Family Echinorhinidae
Genus Echinorhinus
Species Echinorhinus cookei
Name match metric canonicalMatch
Scientific name authorship Pietschmann, 1928
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality East of Townville
Latitude -19.0
Supplied as: "-19"
Longitude 150.0
Supplied as: "150"
Datum EPSG:4326
Coordinate precision Unknown
Terrestrial false
Biome MARINE
Marine true
Country Code AU

Additional properties

genbank accession EU398777
markercode COI-5P
nucleotides CCTATACTTAATCTTTGGTGCCTGAGCGGGGATGGTGGGCACCGCCCTAAGCCTGCTCATCCGGATAGAGCTCGGCCAGCCTGGCACGCTCTTGGGGGACGATCAAATCTACAATGTAATTGTAACCGCCCATGCTTTCGTAATAATCTTTTTCATAGTTATACCAATCATAATCGGAGGGTTCGGAAACTGACTAGTCCCTCTAATGATCGGCGCCCCTGACATGGCCTTCCCACGAATAAATAATATAAGCTTTTGGCTCTTGCCCCCGGCCCTCTTGCTTCTATTAGCCTCAGCGGGGGTAGAAGCGGGGGCCGGAACAGGCTGAACAGTTTATCCCCCCCTTGCAGGCAATCTAGCCCACGCTGGAGCATCCGTGGATTTGGCTATCTTCTCCCTCCACTTAGCCGGAATTTCCTCAATCCTGGTCGCTGTAAATTTTATCACGACTATTATTAATATAAAACCACCAGCCATTTCTCAGTATCAAACACCACTCTTTGTTTGATCTATTCTAGTAACCATAGTCCTTCTCCTACTAGCCCTACCTGTTCTTGCAGCCGCAATCACAATGCTGCTAACCGACCGCAACCTAAACACAACATTCTTTGATCCAGCTGGAGGCGGAGACCCTATTCTCTATCAACACCTA
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:24Z

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate uncertainty meters invalid Warning
    First of the month Warning
    Geodetic datum assumed WGS84 Warning
    Name not supplied Warning
    Show/Hide 75 passed properties
    Show/Hide 7 missing properties
    Show/Hide 30 tests that have not been run

    Inferred associated occurrence details

    This record has been identified as the representative occurrence in a group of associated occurrences. This mean other records have been detected that seem to relate to this record and this particular record has the most detailed information on the occurrence. More information about the duplication detection methods and terminology in use is available here:

    Representative Record
    Record UUID 66da27aa-72dd-4ca2-88c0-805ce6a9a849
    Data Resource BOLD - Australian records
    Coordinates -19.0,150.0
    Related records
    Record UUID 9823f190-d4bd-4c13-bb06-882fafde80db
    Data Resource European Molecular Biology Laboratory Australian Mirror
    Raw Scientific Name Echinorhinus cookei
    Coordinates -19.0,150.0

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Coral Sea
    CAPAD 2012 Marine Coral Sea
    CAPAD 2014 Marine Coral Sea
    CAPAD 2016 Marine Coral Sea
    CAPAD 2018 Marine Coral Sea
    CAPAD 2020 Marine Coral Sea
    Global 200 priority ecoregions - Marine Great Barrier Reef
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Northeast Province
    Marine
    Australia's network of Marine Parks Coral Sea Marine Park
    Continental Shelf Continental Shelf
    Exclusive Economic Zone Exclusive Economic Zone
    FAO Fishery Statistical Areas 71
    Geomorphology of the Australian Margin and adjacent seafloor Terrace
    Global Seagrass Species Richness (2003) 12.00000000
    Marine Ecoregions of the World Coral Sea
    IGBP Land Cover vegetation classification scheme (2011) Water

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.0
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.0
    Endemism (Non-marine) 0.0
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Occurrence Density 0.0 frequency
    Shannon Diversity (H) 0.0 index
    Species Richness 0.0 frequency
    Climate
    WorldClim 2.1: Temperature - annual mean 15.595834 °C
    Distance
    Euclidean Distance to Coast (metres) 286436.22 m
    Marspec Distance to Shore 166.0 km
    Marine
    Great Barrier Reef 100m DEM -575.3629 m
    Marspec Annual Range in Sea Surface Salinity 0.5 100 x psu
    Marspec Annual Range in Sea Surface Temperature 4.5099998 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 2.9199998 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 2.3490999 10,000 x degrees C
    Marspec Bathymetric Slope 0.8 10 x degrees
    Marspec Concavity -0.004 1000 x degrees
    Marspec East/West Aspect 0.63 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.41 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.17 100 x psu
    Marspec Mean Annual Sea Surface Temperature 26.029999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.91 100 x psu
    Marspec North/South Aspect 0.77 1 x radians
    Marspec Plan Curvature -1.0E-4 x 10000
    Marspec Profile Curvature 2.9999999E-4 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 23.779999 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 28.289999 100 x degrees C
    Sea Surface Temperature - MODIS Terra 26.306396 Degrees C
    SeaWIFS K490 Mean 0.028538048 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.08685758 mg/m^3
    Topography
    Averaged Topographic Relief 114.041664 metres
    Bathymetry and Elvation 9 sec -522.0 m
    Topographic Slope (degrees) 0.66037214 degrees