Occurrence record:

EnvironmentalDNA of Clathrus ruber recorded on 2014-05-13

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-05-13
Date precision Day

Taxonomy

Scientific name Clathrus ruber
Taxon rank species
Kingdom Fungi
Phylum Basidiomycota
Class Agaricomycetes
Order Phallales
Family Phallaceae
Genus Clathrus
Species Clathrus ruber
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Australian Capital Territory
Local government area Unincorporated ACT
Locality Namadgi NP
Latitude -35.8748166
Longitude 149.01165
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 1099.0

Additional properties

ammonium nitrogen mg kg 7.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 0.42
broad land use Conservation and Natural Environments
clay 14.31
color LTGR
conductivity dsm ds m 0.042
course sand 31.93
depth m 0.0
detailed land use Conservation and Natural Environments - Nature conservation - National park
dtpa copper mg kg 0.49
dtpa iron mg kg 117.31
dtpa manganese mg kg 43.85
dtpa zinc mg kg 2.61
environment Soil
exc aluminium meq 100g 0.411
exc calcium meq 100g 4.7
exc magnesium meq 100g 1.45
exc potassium meq 100g 0.49
exc sodium meq 100g 0.02
fine sand 28.11
general ecological zone Temperate
gravel 5.0
nitrate nitrogen mg kg 1e-10
otu CTGAATTTATTTTCAAATCCCTTTCACACACCTGTGCACTCTAGCGCGAGGGGAGACCCTCCGCGTTTTTACAATACACCTACGCCTGTCGTACGCATGCGATAAATAAAAAAGTTTATATATAAAAACA
otucount 2
organic carbon 2.55
ph level cacl2 cacl2 4.7
ph level h2o h2o 5.4
phosphorus colwell mg kg 21.0
potassium colwell mg kg 232.0
sample id 102.100.100/8142
sample type Soil
sand 60.04
silt 25.65
slope 7.5
soil moisture 14.6879756468798
sulphur mg kg 4.0
texture 2.5
vegetation type Woodland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 12 missing properties
    Show/Hide 44 tests that have not been run

    Additional political boundaries information

    Area Management
    ACT TAMS Reserves NAMADGI NATIONAL PARK
    CAPAD 2010 Terrestrial Namadgi
    CAPAD 2012 Terrestrial Namadgi
    CAPAD 2014 Terrestrial Namadgi
    CAPAD 2016 Terrestrial Namadgi
    Fallow practice - dominant (area) No practices
    Fallow practice - dominant (number) No practices
    GER Kosciuszko to Coast GER Kosciuszko to Coast
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia Kosciuszko & Namadgi IBA
    Irrigation practice - dominant No irrigation
    Land use Other minimal uses
    Murray Darling Basin Authority Water Quality Zones Montane
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW1
    Murray-Darling Basin Ground Water Plan Areas (2018) Australian Capital Territory (groundwater)
    Murray-Darling Basin Ground Water SDL Resource Units Australian Capital Territory (Groundwater) (GS52)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Australian Capital Territory (Groundwater) (GS52)
    Murray-Darling Basin Surface Water Plan Areas SW1
    Murray-Darling Basin Surface Water Plan Areas (2019) Australian Capital Territory (surface water)
    Murray-Darling Basin Surface Water SDL Resource Units SS1
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Australian Capital Territory (Surface Water)
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys MURRUMBIDGEE
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones montane
    NRM Regions 2010 ACT
    NRM Regions 2014 ACT
    NRM Regions 2015 ACT
    NRM Regions 2017 ACT
    NRM Regions 2017 (Qld 2019) ACT
    Stubble practice - dominant (area) No practices reported
    Stubble practice - dominant (number) No practices reported
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 ACT
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions South Eastern Highlands
    IBRA 6 Sub Regions South Eastern Highlands
    IBRA 7 Regions South Eastern Highlands
    IBRA 7 Subregions Murrumbateman
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Wild woodlands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (mild summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Eucalypt forest (temperate)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions MURRUMBIDGEE RIVER
    Marine
    Marine Ecoregions of the World Cape Howe
    States including coastal waters Australian Capital Territory
    Political
    ASGS Australian States and Territories Australian Capital Territory
    Australian States and Territories Australian Capital Territory
    Commonwealth Electoral Boundaries Canberra
    Local Government Areas 2011 Unincorporated ACT
    Local Government Areas 2012 deprecated Remainder of ACT
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Ngambri, Ngunnawal/Ngunawal, Ngarigu, Wulgalu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Ngambri, Ngunnawal/Ngunawal, Ngarigu, Wolgalu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Ngunnawal/Ngunawal, Wulgalu, Ngambri, Ngarigu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Ngunnawal/Ngunawal, Wolgalu, Ngambri, Ngarigu
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 46
    PSMA ABS Greater Capital City Statistical Areas (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA ABS SA2 Statistical Areas (2016) NAMADGI
    PSMA ABS SA3 Statistical Areas (2016) URRIARRA - NAMADGI
    PSMA ABS SA4 Statistical Areas (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA Commonwealth Electoral Boundaries (2016) CANBERRA
    PSMA Commonwealth Electoral Boundaries (2018) BEAN
    PSMA Indigenous Areas (2016) STROMLO - NAMADGI
    PSMA Indigenous Locations (2016) STROMLO - NAMADGI
    PSMA Indigenous Regions (2016) ACT
    PSMA Localities (2018) MOUNT CLEAR
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (ACT)
    PSMA State Electoral Boundaries (2016) BRINDABELLA
    PSMA State Electoral Boundaries (2018) BRINDABELLA
    PSMA States (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (ACT)
    Statistical Local Areas Remainder of ACT
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Lachlan Region
    Surface Geology of Australia Osa
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 Australian Alps
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous co-managed, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus woodlands with a tussock grass understorey
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Replaced
    Vegetation types - native Tussock grasslands
    Vegetation types - present Tussock grasslands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 2094150.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8992
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.3025
    Endemism 0.03985341
    Endemism (Non-marine) 0.046497528
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 4.0 frequency
    Occurrence Density 68411.0 frequency
    Shannon Diversity (H) 4.71977 index
    Species Richness 1864.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 5.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.5842202
    2030A1BMk35M: Evaporation - month min 35.34 mm
    2030A1BMk35M: Precipitation - annual mean 51.603333 mm
    2030A1BMk35M: Precipitation - driest month 35.04 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1348431
    2030A1BMk35M: Precipitation - spring or autumn season 0.13391568
    2030A1BMk35M: Temperature - annual max mean 16.849167 degrees C
    2030A1BMk35M: Temperature - annual min mean 4.4733334 degrees C
    2030A1BMk35M: Temperature - annual range 26.00998 degrees C
    Aridity index - annual mean 0.78093845
    Aridity index - month max 1.847676
    Aridity index - month min 0.2874505
    Evaporation - annual mean 104.94776 (ml/5km x 5km pixel)
    Evaporation - average 17144.0 ml
    Evaporation - month max 204.57254 mm
    Evaporation - month min 26.648994 mm
    Evaporation - variability 10.0 %
    Growth index C3 macrotherm plants - annual mean 0.01 index
    Growth index C3 mesotherm plants - annual mean 0.14 index
    Growth index C4 megatherm plants - annual mean 0.01 index
    Humidity - annual mean relative 81.675186 %
    Humidity - annual mean relative 3pm 72.457825 %
    Humidity - month max relative 90.108665 %
    Humidity - month max relative 3pm 83.88311 %
    Humidity - month min relative 62.11966 %
    Humidity - month min relative 3pm 62.11966 %
    Precipitation - annual 768.0 mm
    Precipitation - annual (Bio12) 662.0 mm
    Precipitation - annual mean 55.869698 mm
    Precipitation - annual seasonality 0.19519916
    Precipitation - coldest quarter (Bio19) 141.0 mm
    Precipitation - driest month 46.251488 mm
    Precipitation - driest period (Bio14) 9.0 mm
    Precipitation - driest quarter (Bio17) 137.0 mm
    Precipitation - equinox seasonality ratio 1.0865673
    Precipitation - seasonality (Bio15) 16.0 mm
    Precipitation - spring or autumn season 0.08605072
    Precipitation - warmest quarter (Bio18) 183.0 mm
    Precipitation - wettest month 66.563896 mm
    Precipitation - wettest period (Bio13) 17.0 mm
    Precipitation - wettest quarter (Bio16) 196.0 mm
    Radiation - annual mean (Bio20) 16.6 MJ/m2/day
    Radiation - seasonality (Bio23) 38.0
    Radiation - warmest quarter (Bio26) 23.5 MJ/m2/day
    Temperature - annual max mean 14.9366665 degrees C
    Temperature - annual mean (Bio01) 9.5 degrees C
    Temperature - annual min mean 2.67 degrees C
    Temperature - annual range 25.208252 degrees C
    Temperature - annual range (Bio07) 26.3 degrees C
    Temperature - coldest month min -2.59 degrees C
    Temperature - coldest period min (Bio06) -2.5 degrees C
    Temperature - coldest quarter mean (Bio11) 3.3 degrees C
    Temperature - diurnal range mean (Bio02) 12.2 degrees C
    Temperature - driest quarter mean (Bio09) 4.8 degrees C
    Temperature - isothermality (Bio03) 0.46 %
    Temperature - month hottest maximum 22.79 degrees C
    Temperature - seasonality (Bio04) 1.72
    Temperature - warmest month min 8.35 degrees C
    Temperature - warmest period max (Bio05) 23.7 degrees C
    Temperature - warmest quarter (Bio10) 15.7 degrees C
    Temperature - wettest quarter mean (Bio08) 14.1 degrees C
    Wind run - annual mean 146.40936 km/day
    WorldClim: Precipitation - annual 805.0 mm
    WorldClim: Precipitation - coldest quarter 186.0 mm
    WorldClim: Precipitation - driest month 54.0 mm
    WorldClim: Precipitation - driest quarter 170.0 mm
    WorldClim: Precipitation - seasonality 13.0
    WorldClim: Precipitation - warmest quarter 192.0 mm
    WorldClim: Precipitation - wettest month 86.0 mm
    WorldClim: Precipitation - wettest quarter 232.0 mm
    WorldClim: Temperature - annual mean 96.0 degrees C * 10
    WorldClim: Temperature - annual range 271.0 degrees C * 10
    WorldClim: Temperature - coldest month min -30.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 32.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 129.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 40.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 4930.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 241.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 158.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 92.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 1.13565 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.080622576 km
    Euclidean Distance to Coast (metres) 54219.492 m
    Remoteness index 3.6004665
    Hydrology
    Drainage - average 1131.0 megalitres/5x5km/year
    Drainage - variability 137.0 %
    Runoff - average 663.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.20557278 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 70.005646
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 110.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.4 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 26.0 %
    Bulk density 1.4710695 Mg/m^3
    Carbon - organic 4.0002894 %
    Clay % 42.760696 %
    Hydrologic conductivity - average saturated 53.333332 mm/h
    Moisture Index - annual mean (Bio28) 0.63
    Moisture Index - highest quarter mean (Bio32) 0.92
    Nutrient status 1.85 index
    Ph - soil 4.0 ph
    Soil depth 1.0 m
    Soil pedality 3.4187167
    Water holding capacity 44000.0 mm
    Water stress index - month max 79.46478
    Weathering Intensity V2 1.42215 Weathering Intensity Index
    Topography
    Aspect 24.0 degrees
    Averaged Topographic Relief 352.125 metres
    Bathymetry and Elvation 9 sec 1095.0 m
    Elevation 1133.0 m
    Topographic Slope (degrees) 2.2092817 degrees
    Topographic relief 222.7545 m
    Topographic slope (%) 12.01005 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2906 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 54.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 38.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 62.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0336 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.4 m^2 plant / m^2 ground
    NDVI Mean 54.0 NDVI x 100
    NPP Mean 13.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.656 NDVI