We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3747481

GenomicDNA of LEPIDOPTERA | Moths recorded on 2001-09-15

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3747481
Other catalog numbers recordID:1651426;ProcessID:ANICJ742-10;sampleID:10ANIC-06739
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Sandery, K.J.
Supplied as "K.J.Sandery"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Occurrence date 2001-09-15
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Mackay (R)
Locality Bucasia
Latitude -21.037
Longitude 149.158
Geodetic datum EPSG:4326
Coordinate precision Unknown
Georeference protocol Google earth
Biome Terrestrial

Additional properties

genbank accession HQ949960
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGTTTATTAATTCGAGCTGAACTTGGAAATCCTGGTTCATTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCACCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTATTACCTCCTTCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAACTGGAACTGGATGAACTGTTTACCCCCTACTTTCATCAAATATTGCTCATAGAGGAAGATCAGTAGACTTAGCAATTTTTTCCCTTCATTTAGCAGGTATTTCTTCAATTTTAGGTGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTAATATTTGATCAAATACCTTTATTTATTTGAGCTGTGGGTATTACTGCTTTCCTTTTACTTTTATCTTTACCTGTTCTTGCTGGAGCTATTATTATACTTTTAACTGATCGAAATTTAAATACCTCTTTTTTTGACCCCGCTGGTGGAGGAGATCTTATTCTTTATCAACATTTATTC
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Missing georeferenced protocol Passed
    Coordinates dont match supplied state Passed
    Show/Hide 12 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Great Barrier Reef
    Global 200 priority ecoregions - Terrestrial Queensland Tropical Forests
    Irrigation practice - dominant No irrigation
    Land use Other minimal uses
    NRM Regions 2010 Mackay Whitsunday
    NRM Regions 2014 Mackay Whitsunday
    NRM Regions 2015 Mackay Whitsunday
    NRM Regions 2017 Mackay Whitsunday
    NRM Regions 2017 (Qld 2019) Mackay Whitsunday
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Mackay Whitsunday
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions Central Mackay Coast
    IBRA 6 Sub Regions Proserpine - Sarina Lowlands
    IBRA 7 Regions Central Mackay Coast
    IBRA 7 Subregions Proserpine-Sarina Lowlands
    Terrestrial Ecoregional Boundaries Queensland Tropical Rain Forests
    World Anthropogenic Biomes (2000) Residential rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with cooler winter and with a growing season lasting at least six months
    Koppen Climate Classification (All Classes) Subtropical: distinctly dry winter
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Pasture (tropical and subtropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 O'CONNELL RIVER
    River Regions O'CONNELL RIVER
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Dawson
    Local Government Areas 2011 Mackay (R)
    Local Government Areas 2012 deprecated Mackay - Pt A
    Local Government Areas PSMA 2018 MACKAY REGIONAL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 39
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 4479
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) SHOAL POINT - BUCASIA
    PSMA ABS SA3 Statistical Areas (2016) MACKAY
    PSMA ABS SA4 Statistical Areas (2016) MACKAY - ISAAC - WHITSUNDAY
    PSMA Commonwealth Electoral Boundaries (2016) DAWSON
    PSMA Commonwealth Electoral Boundaries (2018) DAWSON
    PSMA Indigenous Areas (2016) MACKAY
    PSMA Indigenous Locations (2016) MACKAY
    PSMA Indigenous Regions (2016) TOWNSVILLE - MACKAY
    PSMA Localities (2018) BUCASIA
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) OTHER URBAN
    PSMA Section of State Range (2016) 50,000 TO 99,999
    PSMA Significant Urban Area (2016) MACKAY
    PSMA State Electoral Boundaries (2016) WHITSUNDAY
    PSMA State Electoral Boundaries (2018) WHITSUNDAY
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) MACKAY
    Statistical Local Areas Mackay (R) - Mackay Pt A
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Proserpine Region
    Surface Geology of Australia Qdc
    Topography
    Physiographic Provinces of Australia Fitzroy Uplands Province
    Physiographic Regions 2011 Townshend Ranges and Lowlands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Mangrove
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Unresolved Tenure
    Vegetation - condition Transformed
    Vegetation types - native Melaleuca forests and woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 3399502.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5489
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.8902
    Endemism 0.01925893
    Endemism (Non-marine) 0.023608828
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 23.0 frequency
    Occurrence Density 8827.0 frequency
    Shannon Diversity (H) 5.8458633 index
    Species Richness 1332.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 5.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.6894654
    2030A1BMk35M: Evaporation - month min 106.55 mm
    2030A1BMk35M: Precipitation - annual mean 123.73667 mm
    2030A1BMk35M: Precipitation - driest month 14.44 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.27223
    2030A1BMk35M: Precipitation - spring or autumn season -2.6538322
    2030A1BMk35M: Temperature - annual max mean 28.071667 degrees C
    2030A1BMk35M: Temperature - annual min mean 19.7425 degrees C
    2030A1BMk35M: Temperature - annual range 18.269989 degrees C
    Aridity index - annual mean 0.82971776
    Aridity index - month max 2.1790147
    Aridity index - month min 0.14406163
    Evaporation - annual mean 161.55075 (ml/5km x 5km pixel)
    Evaporation - month max 222.0272 mm
    Evaporation - month min 98.03184 mm
    Growth index C3 macrotherm plants - annual mean 0.47 index
    Growth index C3 mesotherm plants - annual mean 0.52 index
    Growth index C4 megatherm plants - annual mean 0.38 index
    Humidity - annual mean relative 80.41844 %
    Humidity - annual mean relative 3pm 76.31357 %
    Humidity - month max relative 85.94902 %
    Humidity - month max relative 3pm 79.37646 %
    Humidity - month min relative 73.79408 %
    Humidity - month min relative 3pm 73.79408 %
    Precipitation - annual (Bio12) 1544.0 mm
    Precipitation - annual mean 134.44705 mm
    Precipitation - annual seasonality 1.9955837
    Precipitation - coldest quarter (Bio19) 128.0 mm
    Precipitation - driest month 24.0 mm
    Precipitation - driest period (Bio14) 3.0 mm
    Precipitation - driest quarter (Bio17) 81.0 mm
    Precipitation - equinox seasonality ratio 0.2776616
    Precipitation - seasonality (Bio15) 77.0 mm
    Precipitation - spring or autumn season -2.5834405
    Precipitation - warmest quarter (Bio18) 738.0 mm
    Precipitation - wettest month 355.03085 mm
    Precipitation - wettest period (Bio13) 87.0 mm
    Precipitation - wettest quarter (Bio16) 796.0 mm
    Radiation - annual mean (Bio20) 18.5 MJ/m2/day
    Radiation - seasonality (Bio23) 20.0
    Radiation - warmest quarter (Bio26) 20.7 MJ/m2/day
    Temperature - annual max mean 26.6825 degrees C
    Temperature - annual mean (Bio01) 23.0 degrees C
    Temperature - annual min mean 18.0175 degrees C
    Temperature - annual range 18.200012 degrees C
    Temperature - annual range (Bio07) 18.5 degrees C
    Temperature - coldest month min 11.9 degrees C
    Temperature - coldest period min (Bio06) 12.5 degrees C
    Temperature - coldest quarter mean (Bio11) 18.1 degrees C
    Temperature - diurnal range mean (Bio02) 8.3 degrees C
    Temperature - driest quarter mean (Bio09) 19.9 degrees C
    Temperature - isothermality (Bio03) 0.45 %
    Temperature - month hottest maximum 30.2 degrees C
    Temperature - seasonality (Bio04) 1.17
    Temperature - warmest month min 22.69 degrees C
    Temperature - warmest period max (Bio05) 31.0 degrees C
    Temperature - warmest quarter (Bio10) 26.9 degrees C
    Temperature - wettest quarter mean (Bio08) 26.3 degrees C
    Wind run - annual mean 314.2909 km/day
    WorldClim: Precipitation - annual 1756.0 mm
    WorldClim: Precipitation - coldest quarter 130.0 mm
    WorldClim: Precipitation - driest month 17.0 mm
    WorldClim: Precipitation - driest quarter 85.0 mm
    WorldClim: Precipitation - seasonality 82.0
    WorldClim: Precipitation - warmest quarter 890.0 mm
    WorldClim: Precipitation - wettest month 361.0 mm
    WorldClim: Precipitation - wettest quarter 1006.0 mm
    WorldClim: Temperature - annual mean 227.0 degrees C * 10
    WorldClim: Temperature - annual range 188.0 degrees C * 10
    WorldClim: Temperature - coldest month min 118.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 179.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 92.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 208.0 degrees C * 10
    WorldClim: Temperature - isothermality 48.0 %
    WorldClim: Temperature - seasonality 3343.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 306.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 264.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 261.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.01414214 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.0 km
    Euclidean Distance to Coast (metres) 2420.5916 m
    Remoteness index 2.199646
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.0 Pascals
    Great Barrier Reef 100m DEM 9.0 m
    Sea Surface Temperature - MODIS Terra 24.968487 Degrees C
    SeaWIFS K490 Mean 0.13790026 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 1.5431379 mg/m^3
    Social
    Population - density SLA 2006 p/sqkm) 280.3 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 80.99999
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 31.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.7 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 27.0 %
    Bulk density 1.4360714 Mg/m^3
    Carbon - organic -11597.918 %
    Clay % 5.0 %
    Hydrologic conductivity - average saturated 100.0 mm/h
    Moisture Index - annual mean (Bio28) 0.73
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.0 index
    Soil depth 0.9 m
    Soil pedality 1.8777473
    Water stress index - month max 81.0
    Weathering Intensity V2 3.93821 Weathering Intensity Index
    Topography
    Aspect 51.0 degrees
    Averaged Topographic Relief 112.291664 metres
    Bathymetry and Elvation 9 sec 4.0 m
    Elevation 0.0 m
    Topographic Slope (degrees) 0.2917822 degrees
    Topographic relief 6.519387 m
    Topographic slope (%) 0.3566003 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3334 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 53.0 %
    Fractional Cover - Bare Soil (2012-03-05) 23.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 31.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 46.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0105 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.3 m^2 plant / m^2 ground
    NPP Mean 9.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.5996 NDVI