We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3020532

GenomicDNA of Pseudocyttus maculatus | Smooth Oreodory recorded on 1995-05-19

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3020532
Other catalog numbers recordID:29603;ProcessID:FOA337-04;sampleID:BW-A337
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Associated Occurrence Status Associated record
Associated occurrences The occurrence is associated with a representative record.
For more information see Inferred associated occurrence details
License CC-BY-Int
Occurrence remarks
Occurrence status present
Abcd identification qualifier Not provided

Event

Occurrence date 1995-05-19
Date precision Day

Taxonomy

Scientific name Pseudocyttus maculatus
Taxon rank species
Common name Smooth Oreodory
Kingdom Animalia
Phylum Chordata
Class Actinopterygii
Order Zeiformes
Family Oreosomatidae
Genus Pseudocyttus
Species Pseudocyttus maculatus
Taxonomic issue No issues
Name match metric Canonical name match
The supplied name was parsed into canonical form before a match was found.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Tasmania
Latitude -44.1833
Longitude 146.15
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession DQ108086
markercode COI-5P
nucleotides CCTTTATTTAGTATTTGGTGCCTGAGCCGGCATGGTCGGAACAGCCCTAAGCCTCCTTATTCGAGCTGAACTCAGCCAACCGGGGGCACTCCTTGGGGATGACCAAATTTATAATGTAATCGTTACAGCCCATGCTTTTGTAATAATCTTCTTTATAGTAATACCAATTATGATTGGGGGCTTTGGAAATTGACTTGTCCCGCTAATGATTGGAGCCCCAGATATGGCCTTCCCCCGAATAAACAACATGAGCTTTTGACTTCTCCCCCCTTCCTTCCTTCTCCTCCTCGCCTCGTCAGGGGTTGAAGCCGGAGCTGGAACAGGGTGAACAGTCTACCCGCCCCTAGCAGGCAATTTAGCCCACGCAGGAGCTTCCGTAGATCTAACCATTTTTTCCCTTCACTTAGCAGGTATTTCCTCAATTCTAGGGGCTATTAATTTTATTACAACAATTATTAATATAAAACCTCCCGCCATCTCACAGTACCAAACCCCCTTATTTGTATGGGCCGTGTTAATTACAGCAGTTCTCCTTCTCCTTTCACTCCCAGTTCTAGCAGCKGGAATTACAATACTTCTTACAGACCGTAATCTAAATACCTCTTTCTTTGACCCAGCCGGAGGAGGAGACCCAATTTTATACCAACACTTATTC
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:24Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 13 missing properties
    Show/Hide 48 tests that have not been run

    Inferred associated occurrence details

    This record is associated with the representative record. This mean another record has been detected to be similar to this record, and that the other record (the representative record) has the most detailed information for the occurrence. More information about the duplication detection methods and terminology in use is available here:

    Representative Record
    Record UUID 9e8112b8-4db3-43d9-bb16-3b89b7bdb091
    Data Resource BOLD - Australian records
    Coordinates -44.1833,146.15
    Year 1995
    Month 05
    Day 19
    Related records
    Record UUID 4c974ade-c747-46cf-8cbc-8cdd4aaa715b
    Data Resource BOLD - Australian records
    Coordinates -44.1833,146.15
    Year 1995
    Month 05
    Day 19
    Comments One of the collectors was null or unknown
    Coordinates were identical
    Record UUID 5d748206-41dc-495f-a0b3-d43ec74af480
    Data Resource BOLD - Australian records
    Coordinates -44.1833,146.15
    Year 1995
    Month 05
    Day 19
    Comments One of the collectors was null or unknown
    Coordinates were identical
    Record UUID 4c974ade-c747-46cf-8cbc-8cdd4aaa715b
    Data Resource BOLD - Australian records
    Coordinates -44.1833,146.15
    Year 1995
    Month 05
    Day 19
    Comments One of the collectors was null or unknown
    Coordinates were identical
    Record UUID 5d748206-41dc-495f-a0b3-d43ec74af480
    Data Resource BOLD - Australian records
    Coordinates -44.1833,146.15
    Year 1995
    Month 05
    Day 19
    Comments One of the collectors was null or unknown
    Coordinates were identical

    Additional political boundaries information

    Area Management
    CAPAD 2010 Marine Tasman Fracture
    CAPAD 2012 Marine Tasman Fracture
    CAPAD 2014 Marine Tasman Fracture
    CAPAD 2016 Marine Tasman Fracture
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Tasmania Province
    Marine
    Australia's network of Marine Parks Tasman Fracture Marine Park
    Continental Shelf Continental Shelf
    Exclusive Economic Zone Exclusive Economic Zone
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Pinnacle
    Marine Ecoregions of the World Bassian
    IGBP Land Cover vegetation classification scheme (2011) Water

    Environmental sampling for this location

    Biodiversity
    Endemism 0.047533102
    Endemism (Non-marine) 0.0
    Occurrence Density 175.0 frequency
    Shannon Diversity (H) 3.9574816 index
    Species Richness 77.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 145782.9 m
    Marspec Distance to Shore 60.0 km
    Marine
    Marspec Annual Range in Sea Surface Salinity 0.28 100 x psu
    Marspec Annual Range in Sea Surface Temperature 4.41 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 0.69 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 2.0732 10,000 x degrees C
    Marspec Bathymetric Slope 5.2000003 10 x degrees
    Marspec Concavity 0.038000003 1000 x degrees
    Marspec East/West Aspect -0.11 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.079998 100 x psu
    Marspec Mean Annual Sea Surface Salinity 34.95 100 x psu
    Marspec Mean Annual Sea Surface Temperature 12.799999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.8 100 x psu
    Marspec North/South Aspect 0.98999995 1 x radians
    Marspec Plan Curvature 0.0061 x 10000
    Marspec Profile Curvature 0.0022 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 11.09 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 15.5 100 x degrees C
    Sea Surface Temperature - MODIS Terra 13.136488 Degrees C
    SeaWIFS K490 Mean 0.06760644 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.4127549 mg/m^3
    Topography
    Averaged Topographic Relief 810.0 metres
    Bathymetry and Elvation 9 sec -1043.0 m
    Topographic Slope (degrees) 2.8153496 degrees