Occurrence record: BOLD - Australian records - 3490500

GenomicDNA of LEPIDOPTERA | Moths recorded on 2009-12-26

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3490500
Other catalog numbers recordID:1330684;ProcessID:NSWHJ600-10;sampleID:09-NSWHH-0613
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Hebert, P.D.N.
Supplied as "P.D.N. Hebert"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number 09-NSWHH-0613
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number 09-NSWHH-0613
Record date 2009-12-26
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province New South Wales
Locality Kempsey (A)
Latitude -31.0626
Longitude 153.052
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM380791
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAATTTGATCTGGAATAATTGGTACTTCATTAAGTTTATTAATTCGTGCTGAATTAGGAAATCCAGGATCTTTAATTGGTGATGACCAAATTTATAATACTATTGTAACTAGTCATGCTTTTATTATAATTTTTTTTATAGTAATACCCATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGAGCCCCAGATATAGCATTTCCTCGACTTAATAATATAAGTTTTTGATTACTTCCTCCTTCATTAACTTTACTAATTTCTAGTAGAATTGTTGAAAATGGAGCAGGAACAGGATGAACTGTTTACCCCCCTTTATCATCTAATATTGCACATGGAGGTAGATCTGTAGATCTAGCTATTTTTTCCTTACACTTAGCGGGAATTTCCTCTATTTTAGGGGCAATTAACTTTATTACTACTATTATTAATATAAAATTAAATGGATTAAGATTTGACCAATTACCTCTTTTTGTATGAGCTGTAGGAATTACAGCTTTATTACTACTTCTTTCTTTACCTGTTTTAGCAGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACTTCATTTTTTGACCCTGCAGGAGGGGGAGACCCTATTTTATATCAACATTTATTT
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:46Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Important Bird Areas (IBA) Australia Hastings-Macleay IBA
    Irrigation practice - dominant No irrigation
    Land use Urban intensive uses
    NRM Regions 2010 Northern Rivers
    NRM Regions 2014 North Coast
    NRM Regions 2015 North Coast
    NRM Regions 2017 North Coast
    NRM Regions 2017 (Qld 2019) North Coast
    Stubble practice - dominant (area) Stubble mulched
    Stubble practice - dominant (number) Four practices equal
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 North Coast
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions NSW North Coast
    IBRA 6 Sub Regions Macleay Hastings
    IBRA 7 Regions NSW North Coast
    IBRA 7 Subregions Macleay Hastings
    Terrestrial Ecoregional Boundaries Eastern Australian Temperate Forests
    Climate
    Agroclimatic classification of Australia Warmer and wetter end of the warm, wet sub-tropical climates
    Koppen Climate Classification (All Classes) Subtropical: no dry season
    Koppen Climate Classification (Major Classes) Subtropical
    Hydrology
    Drainage Divisions Level 1 South East Coast (NSW)
    Drainage Divisions Level 2 MACLEAY RIVER
    River Regions MACLEAY RIVER
    Marine
    FAO Fishery Statistical Areas 81
    Marine Ecoregions of the World Manning-Hawkesbury
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Cowper
    Local Government Areas 2011 Kempsey (A)
    Local Government Areas 2012 deprecated Kempsey
    Local Government Areas PSMA 2018 KEMPSEY SHIRE COUNCIL
    NSW Local Land Services Regions North Coast
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 47
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3354
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) KEMPSEY REGION
    PSMA ABS SA3 Statistical Areas (2016) KEMPSEY - NAMBUCCA
    PSMA ABS SA4 Statistical Areas (2016) MID NORTH COAST
    PSMA Commonwealth Electoral Boundaries (2016) COWPER
    PSMA Commonwealth Electoral Boundaries (2018) COWPER
    PSMA Indigenous Areas (2016) KEMPSEY
    PSMA Indigenous Locations (2016) KEMPSEY - SURROUNDS
    PSMA Indigenous Regions (2016) NSW CENTRAL AND NORTH COAST
    PSMA Localities (2018) HAT HEAD
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) BOUNDED LOCALITY
    PSMA Section of State Range (2016) 200 TO 499
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NSW)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) OXLEY
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) HAT HEAD (L)
    Statistical Local Areas Kempsey (A)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia New England Region
    Surface Geology of Australia Psch
    Topography
    Physiographic Provinces of Australia New England-Moreton Uplands Province
    Physiographic Regions 2011 Macleay-Barrington Fall
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Other native forest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation types - native Acacia shrublands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.4148657E7 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.3625
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.6291
    Endemism 0.0075137126
    Endemism (Non-marine) 0.012106189
    Mammals – Fritz et al 2009 - 0.5 degree 0.3794
    Migratory species (2008) 19.0 frequency
    Occurrence Density 22045.0 frequency
    Shannon Diversity (H) 5.10992 index
    Species Richness 1375.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 5.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 1.0737646
    2030A1BMk35M: Evaporation - month min 61.22 mm
    2030A1BMk35M: Precipitation - annual mean 110.99417 mm
    2030A1BMk35M: Precipitation - driest month 36.17 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.48761207
    2030A1BMk35M: Precipitation - spring or autumn season -1.0464272
    2030A1BMk35M: Temperature - annual max mean 24.790833 degrees C
    2030A1BMk35M: Temperature - annual min mean 14.886667 degrees C
    2030A1BMk35M: Temperature - annual range 19.0 degrees C
    Aridity index - annual mean 1.0122323
    Aridity index - month max 1.8677094
    Aridity index - month min 0.47635642
    Evaporation - annual mean 128.10669 (ml/5km x 5km pixel)
    Evaporation - month max 193.68481 mm
    Evaporation - month min 68.95318 mm
    Growth index C3 macrotherm plants - annual mean 0.31 index
    Growth index C3 mesotherm plants - annual mean 0.69 index
    Growth index C4 megatherm plants - annual mean 0.22 index
    Humidity - annual mean relative 82.8436 %
    Humidity - annual mean relative 3pm 78.9335 %
    Humidity - month max relative 87.16066 %
    Humidity - month max relative 3pm 82.24217 %
    Humidity - month min relative 75.13846 %
    Humidity - month min relative 3pm 75.13846 %
    Precipitation - annual (Bio12) 1408.0 mm
    Precipitation - annual mean 118.06434 mm
    Precipitation - annual seasonality 0.2524514
    Precipitation - coldest quarter (Bio19) 221.0 mm
    Precipitation - driest month 61.84185 mm
    Precipitation - driest period (Bio14) 9.0 mm
    Precipitation - driest quarter (Bio17) 164.0 mm
    Precipitation - equinox seasonality ratio 0.52143264
    Precipitation - seasonality (Bio15) 40.0 mm
    Precipitation - spring or autumn season -0.91405755
    Precipitation - warmest quarter (Bio18) 467.0 mm
    Precipitation - wettest month 178.6837 mm
    Precipitation - wettest period (Bio13) 45.0 mm
    Precipitation - wettest quarter (Bio16) 524.0 mm
    Radiation - annual mean (Bio20) 16.7 MJ/m2/day
    Radiation - seasonality (Bio23) 29.0
    Radiation - warmest quarter (Bio26) 20.4 MJ/m2/day
    Temperature - annual max mean 22.771667 degrees C
    Temperature - annual mean (Bio01) 18.6 degrees C
    Temperature - annual min mean 13.26 degrees C
    Temperature - annual range 19.415833 degrees C
    Temperature - annual range (Bio07) 19.0 degrees C
    Temperature - coldest month min 7.91 degrees C
    Temperature - coldest period min (Bio06) 8.3 degrees C
    Temperature - coldest quarter mean (Bio11) 14.2 degrees C
    Temperature - diurnal range mean (Bio02) 9.7 degrees C
    Temperature - driest quarter mean (Bio09) 15.5 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - month hottest maximum 26.35 degrees C
    Temperature - seasonality (Bio04) 1.13
    Temperature - warmest month min 18.31 degrees C
    Temperature - warmest period max (Bio05) 27.2 degrees C
    Temperature - warmest quarter (Bio10) 22.6 degrees C
    Temperature - wettest quarter mean (Bio08) 21.1 degrees C
    Wind run - annual mean 308.5236 km/day
    WorldClim: Precipitation - annual 1478.0 mm
    WorldClim: Precipitation - coldest quarter 282.0 mm
    WorldClim: Precipitation - driest month 54.0 mm
    WorldClim: Precipitation - driest quarter 196.0 mm
    WorldClim: Precipitation - seasonality 35.0
    WorldClim: Precipitation - warmest quarter 507.0 mm
    WorldClim: Precipitation - wettest month 195.0 mm
    WorldClim: Precipitation - wettest quarter 541.0 mm
    WorldClim: Temperature - annual mean 186.0 degrees C * 10
    WorldClim: Temperature - annual range 189.0 degrees C * 10
    WorldClim: Temperature - coldest month min 81.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 140.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 96.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 146.0 degrees C * 10
    WorldClim: Temperature - isothermality 50.0 %
    WorldClim: Temperature - seasonality 3404.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 270.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 226.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 215.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.089999996 degrees
    Distance - to coast 0.0 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.09899495 km
    Euclidean Distance to Coast (metres) 2728.5254 m
    Remoteness index 3.43
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.002702 Pascals
    Sea Surface Temperature - MODIS Terra 21.537354 Degrees C
    SeaWIFS K490 Mean 0.060792193 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.41974285 mg/m^3
    Social
    Population - density SLA 2006 p/sqkm) 8.1 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 59.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.6 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 20.0 %
    Bulk density 1.3532858 Mg/m^3
    Carbon - organic -7925.4165 %
    Clay % 33.67143 %
    Hydrologic conductivity - average saturated 53.333332 mm/h
    Moisture Index - annual mean (Bio28) 0.85
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.25 index
    Ph - soil 4.0 ph
    Soil depth 0.9 m
    Soil pedality 2.5942857
    Water holding capacity 46750.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 2.23143 Weathering Intensity Index
    Topography
    Aspect 289.0 degrees
    Averaged Topographic Relief 115.083336 metres
    Bathymetry and Topography 9 sec 63.0 m
    Elevation 23.0 m
    Topographic Slope (degrees) 0.0759867 degrees
    Topographic relief 47.08654 m
    Topographic slope (%) 5.381624 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4502 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 30.0 %
    Fractional Cover - Bare Soil (2012-03-05) 13.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 29.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 58.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.7 m^2 plant / m^2 ground
    NDVI Mean 56.0 NDVI x 100
    NPP Mean 0.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7806 NDVI