We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3529897

GenomicDNA of Rhodymeniales recorded on 2010-02-02

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3529897
Other catalog numbers recordID:1367746;ProcessID:ABMMC8365-10;sampleID:GWS016625
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector Saunders, G.W.|Kraft, L.|Dixon, K.
Supplied as "G.W. Saunders, L. Kraft & K. Dixon"
License CC-BY-Int
Field number GWS016625
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Gerald T. Kraft

Event

Field number GWS016625
Occurrence date 2010-02-02
Date precision Day

Taxonomy

Scientific name Rhodymeniales
Taxon rank order
Kingdom Plantae
Phylum Rhodophyta
Class Florideophyceae
Order Rhodymeniales
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Victoria
Supplied as: "Tasmania"
Locality Queenscliffe (B)
Locality The Springs, Point Lonsdale
Latitude -38.276
Longitude 144.62
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM918279
markercode COI-5P
nucleotides TACGCTATATTTGATTTTTGGTGCATTCTCGGGAATTCTCGGAGGTTGTATGTCAGTATTAATCCGAATGGAACTTACACAACCAGGTAACCATTTACTTCTAGGTAACCATCAGTTATACAATGTTTTAATTACAGCTCACGCATTTCTGATGATTTTCTTTATGGTTATGCCTGTAATGATTGGTGGTTTTGGTAATTGGTTGGTTCCTATTATGATAGGCAGTCCTGATATGGCTTTTCCAAGATTAAATAACATTTCTTTTTGATTACTACCACCAGCTCTTTGCTTGTTACTAACTTCAGCTTTAGTAGAAGTAGGTGTAGGTACTGGGTGAACTGTATACCCACCACTTAGTTCAATTCAAAGCCATTCTGGCGGAGCTGTTGACTTAGCTATATTTAGCCTTCATGTTTCTGGAGCTTCCTCTATATTAGGAGCTATTAATTTTATTTCAACAATCATAAATATGCGTAATTCAGGACAAAGCATGTATCGAATACCTTTATTCGTTTGGTCAATACTTGTGACAGCTTTTCTATTGTTACTAGCAGTACCTGTATTAGCAGGAGCTATCACTATGCTTTTAACGGACCGTAATTTTAACACCACATTCTTTGATCCCGCTGGTGGTGGAGATCCTATTTTGTACCAACATCTATTT
Owner institution code University of New Brunswick, Fredericton
sequence last updated 2011-11-14T08:11:41Z

User flagged issues 

    Data quality tests

    Test name Result
    Coordinates dont match supplied state Failed
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    NRM Regions 2010 Corangamite
    NRM Regions 2014 Corangamite
    NRM Regions 2015 Corangamite
    NRM Regions 2017 Corangamite
    NRM Regions 2017 (Qld 2019) Corangamite
    Area management
    National Landcare Program Management Units 2018 Corangamite
    Biodiversity
    Freshwater Ecoregions of the World Bass Strait Drainages
    IBRA 6 Regions South East Coastal Plain
    IBRA 6 Sub Regions Otway Plain
    IBRA 7 Regions South East Coastal Plain
    IBRA 7 Subregions Otway Plain
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Mixed settlements
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Hydrology
    Drainage Divisions Level 1 South East Coast (Victoria)
    Drainage Divisions Level 2 BARWON RIVER-LAKE CORANGAMITE
    River Regions BARWON RIVER-LAKE CORANGAMITE
    Marine
    Marine Ecoregions of the World Bassian
    States including coastal waters Victoria (including Coastal Waters)
    Political
    ASGS Australian States and Territories Victoria
    Australian States and Territories Victoria
    Commonwealth Electoral Boundaries Corangamite
    Local Government Areas 2011 Queenscliffe (B)
    Local Government Areas 2012 deprecated Queenscliffe
    Local Government Areas PSMA 2018 QUEENSCLIFFE BOROUGH
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 27
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 2415
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF VIC.
    PSMA ABS SA2 Statistical Areas (2016) POINT LONSDALE - QUEENSCLIFF
    PSMA ABS SA3 Statistical Areas (2016) SURF COAST - BELLARINE PENINSULA
    PSMA ABS SA4 Statistical Areas (2016) GEELONG
    PSMA Commonwealth Electoral Boundaries (2016) CORANGAMITE
    PSMA Commonwealth Electoral Boundaries (2018) CORANGAMITE
    PSMA Indigenous Areas (2016) GEELONG - QUEENSCLIFF
    PSMA Indigenous Locations (2016) GEELONG - QUEENSCLIFF
    PSMA Indigenous Regions (2016) VICTORIA EXC. MELBOURNE
    PSMA Localities (2018) POINT LONSDALE
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) OTHER URBAN
    PSMA Section of State Range (2016) 1,000 TO 4,999
    PSMA Significant Urban Area (2016) GEELONG
    PSMA State Electoral Boundaries (2016) BELLARINE
    PSMA State Electoral Boundaries (2018) WESTERN VICTORIA
    PSMA States (2016) VICTORIA
    PSMA Urban Centre and Locality (2016) POINT LONSDALE - QUEENSCLIFF
    PSMA Wards (2018) QUEENSCLIFFE
    Statistical Local Areas Queenscliffe (B)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Otway Region
    Surface Geology of Australia Qdc
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 West Victorian Plains
    Vegetation
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.9488
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.171
    Endemism 0.04232579
    Endemism (Non-marine) 0.05053316
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 20.0 frequency
    Occurrence Density 218154.0 frequency
    Shannon Diversity (H) 5.316007 index
    Species Richness 3655.0 frequency
    Threatened species (2008) 8.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.53413665
    2030A1BMk35M: Evaporation - month min 47.974 mm
    2030A1BMk35M: Precipitation - annual mean 46.72975 mm
    2030A1BMk35M: Precipitation - driest month 28.618 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1633706
    2030A1BMk35M: Precipitation - spring or autumn season 0.1621782
    2030A1BMk35M: Temperature - annual max mean 19.600916 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.305333 degrees C
    2030A1BMk35M: Temperature - annual range 17.326996 degrees C
    Precipitation - annual (Bio12) 626.25 mm
    Precipitation - coldest quarter (Bio19) 180.0 mm
    Precipitation - driest period (Bio14) 8.0 mm
    Precipitation - driest quarter (Bio17) 114.0 mm
    Precipitation - seasonality (Bio15) 19.5 mm
    Precipitation - warmest quarter (Bio18) 114.0 mm
    Precipitation - wettest period (Bio13) 15.25 mm
    Precipitation - wettest quarter (Bio16) 189.0 mm
    Radiation - annual mean (Bio20) 15.3 MJ/m2/day
    Radiation - seasonality (Bio23) 46.0
    Radiation - warmest quarter (Bio26) 22.3 MJ/m2/day
    Temperature - annual mean (Bio01) 14.4 degrees C
    Temperature - annual range (Bio07) 17.3 degrees C
    Temperature - coldest period min (Bio06) 6.4 degrees C
    Temperature - coldest quarter mean (Bio11) 10.5 degrees C
    Temperature - diurnal range mean (Bio02) 8.0 degrees C
    Temperature - driest quarter mean (Bio09) 18.375 degrees C
    Temperature - isothermality (Bio03) 0.46 %
    Temperature - seasonality (Bio04) 1.0725
    Temperature - warmest period max (Bio05) 23.7 degrees C
    Temperature - warmest quarter (Bio10) 18.4 degrees C
    Temperature - wettest quarter mean (Bio08) 11.8 degrees C
    Wind run - annual mean 341.80417 km/day
    Distance
    Distance - to any water (weighted) 0.02 degrees
    Distance - to coast 0.0 km x 100
    Distance - to non-permanent water (weighted) 0.17999999 degrees
    Distance - to permanent water (weighted) 0.02 km
    Euclidean Distance to Coast (metres) 7947.4634 m
    Remoteness index 0.59
    Hydrology
    Water Observations From Space 63.52941 Percentage
    Marine
    GEOMACS - geometric mean 0.183574 Pascals
    Sea Surface Temperature - MODIS Terra 15.49268 Degrees C
    Substrate
    2030A1BMk35M: Water stress index - month max 76.951675
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 181.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.51 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 15.0 %
    Bulk density 1.1462069 Mg/m^3
    Clay % 5.9827585 %
    Hydrologic conductivity - average saturated 300.0 mm/h
    Moisture Index - annual mean (Bio28) 0.605
    Moisture Index - highest quarter mean (Bio32) 0.94
    Nutrient status 1.0 index
    Soil depth 0.6 m
    Soil pedality 1.3793104
    Water holding capacity 74000.0 mm
    Weathering Intensity V2 5.05074 Weathering Intensity Index
    Topography
    Aspect 117.0 degrees
    Averaged Topographic Relief 71.125 metres
    Bathymetry and Elvation 9 sec 1.0 m
    Elevation 0.0 m
    Topographic Slope (degrees) 0.31561062 degrees
    Topographic relief 0.9764392 m
    Topographic slope (%) 0.11291 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.0121 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 21.0 %
    Gross Primary Productivity (2012-03-13) 0.0122 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NPP Mean 0.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.1122 NDVI