Occurrence record: BOLD - Australian records - 3950862

GenomicDNA of LEPIDOPTERA | Moths recorded on 2010-10-20

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3950862
Other catalog numbers recordID:1818839;ProcessID:PHLCA253-11;sampleID:BIOUG00789-F03
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Carr, C. Christy|Hebert, P. Paul|Kirk, S. Stephanie|Mccormick, J. Jaclyn|Rougerie, R. Rodolphe|Sones, J. Jayme
Supplied as "Christy Carr, Paul Hebert, Stephanie Kirk, Jaclyn McCormick, Rodolphe Rougerie, Jayme Sones"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number L#2010AUS-0049
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number L#2010AUS-0049
Record date 2010-10-20
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Australian Capital Territory
Supplied as: "New South Wales"
Locality Unincorporated ACT
Locality 8 Moss Street
Latitude -35.261
Longitude 149.059
Geodetic datum EPSG:4326
Coordinate precision Unknown
Georeference protocol GPS
Biome Terrestrial

Additional properties

genbank accession JN262215
markercode COI-5P
nucleotides GACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGTACATCTTTAAGTTTACTAATTCGAGCTGAATTAGGAAACCCAGGTTCTTTAATTGGAGATGACCAAATTTATAATACTATTGTTACAGCCCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGAGCCCCAGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGATTACTCCCCCCTTCTTTAACTTTATTAATTTCTAGAAGTATCGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCCTTATCTTCTAATATTGCCCATAGAGGAAGATCTGTAGACTTAGCCATCTTTTCCCTTCATTTAGCTGGAGCTTCATCTATTATAGGTGCCATTAATTTTATTACAACAATTATTAATATACGATTAAATAATATATCATTTGATCAAATACCTCTATTTGTTTGAGCAGTAGGGATTACAGCATTTTTATTATTACTTTCTTTACCTGTATTAGCAGGAGCTATTACTATATTGTTAACTGATCGAAATTTAAATACTTCTTTTTTTGATCCTGCAGGAGGGGGAGATCCAATTCTTTATCAACATTTATTT
Owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:48Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Coordinates dont match supplied state Failed
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Missing georeferenced protocol Passed
    Show/Hide 12 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    GER Kosciuszko to Coast GER Kosciuszko to Coast
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia South-west Slopes of NSW IBA
    Irrigation practice - dominant No irrigation
    Land use Modified pastures
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW1
    Murray-Darling Basin Ground Water Plan Areas (2018) Australian Capital Territory (groundwater)
    Murray-Darling Basin Ground Water SDL Resource Units Australian Capital Territory (Groundwater) (GS52)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Australian Capital Territory (Groundwater) (GS52)
    Murray-Darling Basin Surface Water Plan Areas SW1
    Murray-Darling Basin Surface Water Plan Areas (2019) Australian Capital Territory (surface water)
    Murray-Darling Basin Surface Water SDL Resource Units SS1
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Australian Capital Territory (Surface Water)
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys MURRUMBIDGEE
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones upland
    NRM Regions 2010 ACT
    NRM Regions 2014 ACT
    NRM Regions 2015 ACT
    NRM Regions 2017 ACT
    NRM Regions 2017 (Qld 2019) ACT
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 ACT
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions South Eastern Highlands
    IBRA 6 Sub Regions South Eastern Highlands
    IBRA 7 Regions South Eastern Highlands
    IBRA 7 Subregions Murrumbateman
    Terrestrial Ecoregional Boundaries Southeast Australia Temperate Forests
    World Anthropogenic Biomes (2000) Mixed settlements
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions MURRUMBIDGEE RIVER
    Marine
    Marine Ecoregions of the World Cape Howe
    States including coastal waters Australian Capital Territory
    Political
    ASGS Australian States and Territories Australian Capital Territory
    Australian States and Territories Australian Capital Territory
    Commonwealth Electoral Boundaries Fraser
    Local Government Areas 2011 Unincorporated ACT
    Local Government Areas 2012 deprecated Cook
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Ngambri, Ngunnawal/Ngunawal, Ngarigu, Wulgalu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Ngambri, Ngunnawal/Ngunawal, Ngarigu, Wolgalu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Ngunnawal/Ngunawal, Wulgalu, Ngambri, Ngarigu
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Ngunnawal/Ngunawal, Wolgalu, Ngambri, Ngarigu
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 64
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3162
    PSMA ABS Greater Capital City Statistical Areas (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA ABS SA2 Statistical Areas (2016) MOLONGLO CORRIDOR
    PSMA ABS SA3 Statistical Areas (2016) BELCONNEN
    PSMA ABS SA4 Statistical Areas (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA Commonwealth Electoral Boundaries (2016) FENNER
    PSMA Commonwealth Electoral Boundaries (2018) CANBERRA
    PSMA Indigenous Areas (2016) CANBERRA - NORTH
    PSMA Indigenous Locations (2016) BELCONNEN
    PSMA Indigenous Regions (2016) ACT
    PSMA Localities (2018) BELCONNEN
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (ACT)
    PSMA State Electoral Boundaries (2016) GINNINDERRA
    PSMA State Electoral Boundaries (2018) GINNINDERRA
    PSMA States (2016) AUSTRALIAN CAPITAL TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (ACT)
    Statistical Local Areas Belconnen - SSD Bal
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Lachlan Region
    Surface Geology of Australia Sfdw
    Topography
    Physiographic Provinces of Australia Kosciuszkan Uplands Province
    Physiographic Regions 2011 Werriwa Tablelands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Transformed
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 2094150.0 $
    Natural resource management expenditure - additional 1.0 $/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 4.6961
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.381
    Endemism 0.038606327
    Endemism (Non-marine) 0.047146842
    Mammals – Fritz et al 2009 - 0.5 degree 0.6197
    Migratory species (2008) 5.0 frequency
    Occurrence Density 664901.0 frequency
    Shannon Diversity (H) 4.4352946 index
    Species Richness 4353.0 frequency
    Threatened communities (2008) 1.0 frequency
    Threatened species (2008) 9.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.58637774
    2030A1BMk35M: Aridity index - month max 1.2347806
    2030A1BMk35M: Aridity index - month min 0.23638834
    2030A1BMk35M: Evaporation - annual mean 119.37583 mm
    2030A1BMk35M: Evaporation - month max 222.66 mm
    2030A1BMk35M: Evaporation - month min 38.38 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.08 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.26 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.06 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 68.47273 %
    2030A1BMk35M: Humidity - month max relative 3pm 80.66169 %
    2030A1BMk35M: Humidity - month min relative 3pm 56.980965 %
    2030A1BMk35M: Precipitation - annual mean 52.173332 mm
    2030A1BMk35M: Precipitation - driest month 42.15 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1551747
    2030A1BMk35M: Precipitation - max difference between successive months 0.6325805 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.52824724 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 1.2828282
    2030A1BMk35M: Precipitation - spring or autumn season 0.15411
    2030A1BMk35M: Precipitation - summer or winter season 0.2807878
    2030A1BMk35M: Precipitation - wettest month 70.06 mm
    2030A1BMk35M: Precipitation deficit - annual mean -67.2025 mm
    2030A1BMk35M: Precipitation deficit - month max -162.97 mm
    2030A1BMk35M: Precipitation deficit - month min 9.68 mm
    2030A1BMk35M: Radiation - max month precipitation modified 25.92 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 17.011667 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 7.87 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 20.845833 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.0725 degrees C
    2030A1BMk35M: Temperature - annual range 27.529999 degrees C
    2030A1BMk35M: Temperature - coldest month min 1.45 degrees C
    2030A1BMk35M: Temperature - coolest month max 12.11 degrees C
    2030A1BMk35M: Temperature - max difference in max 3.4299927 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.7000122 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 14.720001 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 12.773338 degrees C
    2030A1BMk35M: Temperature - min difference in max -4.470001 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -3.7599792 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 10.320007 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 28.98 degrees C
    2030A1BMk35M: Temperature - warmest month min 14.48 degrees C
    Aridity index - annual mean 0.6770381
    Aridity index - month max 1.4254955
    Aridity index - month min 0.23858562
    Evaporation - annual mean 121.35428 (ml/5km x 5km pixel)
    Evaporation - average 14724.0 ml
    Evaporation - month max 233.20386 mm
    Evaporation - month min 36.52413 mm
    Evaporation - variability 14.0 %
    Growth index C3 macrotherm plants - annual mean 0.05 index
    Growth index C3 mesotherm plants - annual mean 0.22 index
    Growth index C4 megatherm plants - annual mean 0.04 index
    Humidity - annual mean relative 81.666084 %
    Humidity - annual mean relative 3pm 67.76495 %
    Humidity - month max relative 93.61619 %
    Humidity - month max relative 3pm 79.870384 %
    Humidity - month min relative 56.292667 %
    Humidity - month min relative 3pm 56.292667 %
    Precipitation - annual 701.0 mm
    Precipitation - annual (Bio12) 681.0 mm
    Precipitation - annual (log) seasonality index 0.021630593
    Precipitation - annual mean 58.14888 mm
    Precipitation - annual seasonality 0.13349561
    Precipitation - annual seasonality ratio 1.1339039
    Precipitation - autumn 169.0 mm
    Precipitation - autumn reliability 34.0 %
    Precipitation - coldest quarter (Bio19) 161.0 mm
    Precipitation - driest month 49.0 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 143.0 mm
    Precipitation - equinox seasonality ratio 1.1562557
    Precipitation - max difference between successive months 0.42258066 mm/day
    Precipitation - min difference between successive months -0.4393809 mm/day
    Precipitation - seasonality (Bio15) 14.0 mm
    Precipitation - solstice seasonality ratio 1.1099957
    Precipitation - spring 194.0 mm
    Precipitation - spring or autumn (log) season 0.028114762
    Precipitation - spring or autumn season 0.15533663
    Precipitation - spring reliability 55.0 %
    Precipitation - summer 172.0 mm
    Precipitation - summer or winter (log) season 0.020464538
    Precipitation - summer or winter season 0.10930398
    Precipitation - summer reliability 41.0 %
    Precipitation - warmest quarter (Bio18) 171.0 mm
    Precipitation - wettest month 72.0 mm
    Precipitation - wettest period (Bio13) 17.0 mm
    Precipitation - wettest quarter (Bio16) 198.0 mm
    Precipitation - winter 158.0 mm
    Precipitation - winter reliability 55.0 %
    Precipitation deficit - annual mean -63.205395 mm
    Precipitation deficit - month max -175.5252 mm
    Precipitation deficit - month min 16.118435 mm
    Radiation - annual mean (Bio20) 16.9 MJ/m2/day
    Radiation - coldest quarter (Bio27) 9.2 MJ/m2/day
    Radiation - driest quarter (Bio25) 10.3 MJ/m2/day
    Radiation - highest period (Bio21) 26.1 MJ/m2/day
    Radiation - lowest period (Bio22) 7.5 MJ/m2/day
    Radiation - max month precipitation modified 25.659277 MJ/m2/day
    Radiation - mean annual precipitation modified 16.835112 MJ/m2/day
    Radiation - min month precipitation modified 7.8 MJ/m2/day
    Radiation - seasonality (Bio23) 38.0
    Radiation - warmest quarter (Bio26) 23.9 MJ/m2/day
    Radiation - wettest quarter (Bio24) 20.2 MJ/m2/day
    Temperature - annual max mean 18.588333 degrees C
    Temperature - annual mean (Bio01) 13.3 degrees C
    Temperature - annual min mean 6.6633334 degrees C
    Temperature - annual range 26.662079 degrees C
    Temperature - annual range (Bio07) 27.7 degrees C
    Temperature - coldest month min 0.72 degrees C
    Temperature - coldest period min (Bio06) 0.5 degrees C
    Temperature - coldest quarter mean (Bio11) 6.6 degrees C
    Temperature - coolest month max 10.16 degrees C
    Temperature - diurnal range mean (Bio02) 12.6 degrees C
    Temperature - driest quarter mean (Bio09) 10.0 degrees C
    Temperature - isothermality (Bio03) 0.45 %
    Temperature - max absolute mean max 41.0 degrees C
    Temperature - max difference in max 3.560028 degrees C/day
    Temperature - max difference in min 2.710022 degrees C/day
    Temperature - max month diurnal range 14.109985 degrees C
    Temperature - mean annual absolute mean min -4.62853 degrees C
    Temperature - mean annual diurnal range 11.924991 degrees C
    Temperature - min absolute mean min -7.887584 degrees C
    Temperature - min difference in max -4.779999 degrees C/day
    Temperature - min difference in min -3.769989 degrees C/day
    Temperature - min month diurnal range 9.23999 degrees C
    Temperature - month hottest maximum 26.71 degrees C
    Temperature - month mean absolute max 36.157646 degrees C
    Temperature - seasonality (Bio04) 1.83
    Temperature - warmest month min 12.73 degrees C
    Temperature - warmest period max (Bio05) 28.2 degrees C
    Temperature - warmest quarter (Bio10) 20.0 degrees C
    Temperature - wettest quarter mean (Bio08) 13.1 degrees C
    Vapour pressure deficit - annual mean 0.25992864 KPa
    Vapour pressure deficit - annual mean 9am 0.42587548 KPa
    Vapour pressure deficit - month max 0.7957531 KPa
    Vapour pressure deficit - month max 9am 0.7957531 KPa
    Vapour pressure deficit - month min 0.0 KPa
    Vapour pressure deficit - month min 9am 0.19144064 KPa
    Wind run - annual mean 151.55699 km/day
    Wind run - month max 173.69939 km/day
    Wind run - month min 123.36461 km/day
    Wind speed - annual mean 3pm 3.5083332 m/s
    Wind speed - annual mean 9am 2.3166666 m/s
    Wind speed - annual mean 9am or 3pm 3.5 m/s
    Wind speed - month max 3pm 4.1 m/s
    Wind speed - month max 9am 2.9 m/s
    Wind speed - month max 9am or 3pm 4.1 m/s
    Wind speed - month min 3pm 3.0 m/s
    Wind speed - month min 9am 1.9 m/s
    Wind speed - month min 9am or 3pm 1.9 m/s
    WorldClim: Precipitation - annual 704.0 mm
    WorldClim: Precipitation - coldest quarter 163.0 mm
    WorldClim: Precipitation - driest month 46.0 mm
    WorldClim: Precipitation - driest quarter 153.0 mm
    WorldClim: Precipitation - seasonality 13.0
    WorldClim: Precipitation - warmest quarter 171.0 mm
    WorldClim: Precipitation - wettest month 74.0 mm
    WorldClim: Precipitation - wettest quarter 202.0 mm
    WorldClim: Temperature - annual mean 126.0 degrees C * 10
    WorldClim: Temperature - annual range 284.0 degrees C * 10
    WorldClim: Temperature - coldest month min -5.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 58.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 133.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 92.0 degrees C * 10
    WorldClim: Temperature - isothermality 46.0 %
    WorldClim: Temperature - seasonality 5284.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 279.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 194.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 122.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 1.225602 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.022360679 km
    Euclidean Distance to Coast (metres) 60377.375 m
    Remoteness index 0.0
    Fire
    Fire - time since last 6.0 years
    Fire frequency 1.0 frequency
    Hydrology
    Drainage - average 1184.0 megalitres/5x5km/year
    Drainage - variability 117.0 %
    Runoff - average 300.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Disadvantaged 1145.5829 points (mean=1000)
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.5647454
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.23638834
    2030A1BMk35M: Water deficit - month max 141.62799 mm
    2030A1BMk35M: Water deficit - month mean 55.16854 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.246372 MPa
    2030A1BMk35M: Water potential - month max -0.21975559 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 50.827084
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 21.274952
    2030A1BMk35M: Water surplus - annual mean 0.0 mm
    2030A1BMk35M: Water surplus - month max 0.0 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 74.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.4 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 15.0 %
    Bouguer gravity anomalies -492.8629 Gal
    Bulk density 1.5332901 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 1.3007573 %
    Carbon store pre-European 130.8156 kgC/ha
    Clay % 34.017357 %
    Crop factor - annual mean 0.61699915
    Crop factor - month max 0.90000004
    Crop factor - month min 0.23858562
    Erodibility 61.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 1426.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 51.0 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 5.3 my
    Lithology - fertility 4.0 index
    Lithology - mean age 425.55 my
    Lithology - mean age (log) 2.6289506 log my
    Lithology - mean age range (log) 0.7242759 log my
    Magnetic anomalies -30.0 nT
    Moisture - average 48.0 %
    Moisture - variability 11.0 %
    Moisture Index - annual mean (Bio28) 0.57
    Moisture Index - coldest quarter mean (Bio35) 0.83
    Moisture Index - highest period (Bio29) 0.93
    Moisture Index - highest quarter mean (Bio32) 0.9
    Moisture Index - lowest period (Bio30) 0.21
    Moisture Index - lowest quarter mean (Bio33) 0.27
    Moisture Index - seasonality (Bio31) 44.0
    Moisture Index - warmest quarter mean (Bio34) 0.27
    Nitrogen - plant-available pre-European 11236.81 kgN/ha
    Nitrogen concentration pre-European 52.68261 mgN kg/H2O
    Nitrogen store pre-European 59.57673 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 2.7409327
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 10.97008 kgP/ha
    Phosphorus - plant-available total pre-European 1338.5883 kgP/ha
    Phosphorus pre-European 9.700639 mgP kg/H2O
    Soil depth 1.1 m
    Soil pedality 2.7409327
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 3.871141
    Unreliable water retention parameters 38.5
    Water deficit - month max 152.47269 mm
    Water deficit - month mean 51.069965 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 53000.0 mm
    Water holding capacity - plant-available 113.0 mm
    Water potential - annual mean -0.99750626 MPa
    Water potential - month max -0.006597115 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 55.529926
    Water stress index - month max 81.0
    Water stress index - month min 21.472706
    Water surplus - annual mean 0.0 mm
    Water surplus - month max 0.0 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 3.03196 Weathering Intensity Index
    Topography
    Aspect 25.0 degrees
    Averaged Topographic Relief 181.04167 metres
    Bathymetry and Topography 9 sec 658.0 m
    Elevation 636.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 1.9789724 degrees
    Topographic relief 54.13074 m
    Topographic roughness 2.29421 %
    Topographic slope (%) 3.653375 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3795 EVI
    Fractional Cover - Bare Soil (2012-03-05) 14.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 19.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 68.0 % Persistent Vegetation
    NDVI Mean 53.0 NDVI x 100
    NPP Mean 0.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.6693 NDVI
    Phenology peak day of year 2002 dry 102.77778 Day
    Phenology peak day of year 2012 wet 62.77778 Day