Occurrence record: BOLD - Australian records - 3547840

GenomicDNA of LEPIDOPTERA | Moths recorded on 2009-03-31

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3547840
Other catalogue numbers recordID:1414006;ProcessID:GWORV335-10;sampleID:BC EF Alc 00759
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number BC EF Alc 00759
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Alc 00759
Record date 2009-03-31
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Northern Territory
Local government area West Arnhem (S)
Locality East Alligator River
Latitude -12.4242
Longitude 132.964
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM911125
markercode COI-5P
nucleotides AACATTATATTTCATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGTCTATTAATTCGAGCTGAATTAGGAAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAGTTCCATTAATACTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATGGAGGAACTTCAGTAGATCTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTCGATCAAATACCTTTATTTGTTTGAGCTGTAGGGATTACAGCATTCTTATTACTATTATCTTTACCAGTTTTAGCTGGAGCCATTACTATACTTCTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:19Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    CAPAD 2010 Terrestrial Kakadu
    CAPAD 2012 Terrestrial Kakadu
    CAPAD 2014 Terrestrial Kakadu National Park
    CAPAD 2016 Terrestrial Kakadu
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Important Bird Areas (IBA) Australia Kakadu Savanna IBA
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 Northern Territory
    NRM Regions 2014 Northern Territory
    NRM Regions 2015 Northern Territory
    NRM Regions 2017 Northern Territory
    NRM Regions 2017 (Qld 2019) Northern Territory
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Northern Territory
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Arnhem Plateau
    IBRA 6 Sub Regions Arnhem Plateau P1
    IBRA 7 Regions Arnhem Plateau
    IBRA 7 Subregions Alligator
    Terrestrial Ecoregional Boundaries Arnhem Land Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with plant growth determined by moisture availability
    Koppen Climate Classification (All Classes) Tropical: savanna
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    Hydrology
    Drainage Divisions Level 1 Tanami-Timor Sea Coast
    Drainage Divisions Level 2 EAST ALLIGATOR RIVER
    River Regions EAST ALLIGATOR RIVER
    Marine
    Marine Ecoregions of the World Arnhem Coast to Gulf of Carpenteria
    States including coastal waters Northern Territory (including Coastal Waters)
    Political
    ASGS Australian States and Territories Northern Territory
    Australian States and Territories Northern Territory
    Commonwealth Electoral Boundaries Lingiari
    Local Government Areas 2011 West Arnhem (S)
    Local Government Areas 2012 deprecated South Alligator
    Local Government Areas PSMA 2018 WEST ARNHEM REGION
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 206
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 485
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NT
    PSMA ABS SA2 Statistical Areas (2016) ALLIGATOR
    PSMA ABS SA3 Statistical Areas (2016) DALY - TIWI - WEST ARNHEM
    PSMA ABS SA4 Statistical Areas (2016) NORTHERN TERRITORY - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) LINGIARI
    PSMA Commonwealth Electoral Boundaries (2018) LINGIARI
    PSMA Indigenous Areas (2016) KAKADU - MARRAKAI - JABIRU
    PSMA Indigenous Locations (2016) KAKADU - MARRAKAI - SURROUNDS
    PSMA Indigenous Regions (2016) JABIRU - TIWI
    PSMA Localities (2018) KAKADU
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NT)
    PSMA State Electoral Boundaries (2016) ARAFURA
    PSMA State Electoral Boundaries (2018) ARAFURA
    PSMA States (2016) NORTHERN TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NT)
    PSMA Wards (2018) KAKADU WARD
    Statistical Local Areas West Arnhem (S) Bal
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Pine Creek Region
    Surface Geology of Australia Lshe
    Topography
    Physiographic Provinces of Australia North Australian Plateaus Province
    Physiographic Regions 2011 Top End Coastal Plains
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous managed, Native forest
    Forests of Australia (2013) v2.0 Rainforest
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    NVIS 4.1 Major Vegetation Subgroups Dry rainforest or vine thickets
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Other grasslands,herblands, sedgelands and rushlands
    Vegetation types - present Other grasslands, herblands, sedgelands and rushlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 1.0309905E7 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6754
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.7138
    Endemism 0.020854274
    Endemism (Non-marine) 0.02200965
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Migratory species (2008) 9.0 frequency
    Occurrence Density 30887.0 frequency
    Shannon Diversity (H) 6.138294 index
    Species Richness 2234.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 6.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.6000783
    2030A1BMk35M: Evaporation - month min 165.54 mm
    2030A1BMk35M: Precipitation - annual mean 112.985 mm
    2030A1BMk35M: Precipitation - driest month 0.0 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.2703576
    2030A1BMk35M: Precipitation - spring or autumn season -2.6721895
    2030A1BMk35M: Temperature - annual max mean 34.927498 degrees C
    2030A1BMk35M: Temperature - annual min mean 23.436666 degrees C
    2030A1BMk35M: Temperature - annual range 18.649994 degrees C
    Aridity index - annual mean 0.67362016
    Aridity index - month max 2.1857085
    Aridity index - month min 0.0053908355
    Evaporation - annual mean 182.61696 (ml/5km x 5km pixel)
    Evaporation - average 23445.0 ml
    Evaporation - month max 237.8 mm
    Evaporation - month min 143.83069 mm
    Evaporation - variability 9.0 %
    Growth index C3 macrotherm plants - annual mean 0.44 index
    Growth index C3 mesotherm plants - annual mean 0.13 index
    Growth index C4 megatherm plants - annual mean 0.42 index
    Humidity - annual mean relative 79.30318 %
    Humidity - annual mean relative 3pm 60.731556 %
    Humidity - month max relative 88.6614 %
    Humidity - month max relative 3pm 75.01478 %
    Humidity - month min relative 51.01507 %
    Humidity - month min relative 3pm 51.01507 %
    Precipitation - annual 1348.0 mm
    Precipitation - annual (Bio12) 1475.0 mm
    Precipitation - annual mean 111.58875 mm
    Precipitation - annual seasonality 12.420054
    Precipitation - coldest quarter (Bio19) 4.0 mm
    Precipitation - driest month 1.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 3.0 mm
    Precipitation - equinox seasonality ratio 0.39854336
    Precipitation - seasonality (Bio15) 115.0 mm
    Precipitation - spring or autumn season -1.4983342
    Precipitation - warmest quarter (Bio18) 363.0 mm
    Precipitation - wettest month 314.37198 mm
    Precipitation - wettest period (Bio13) 93.0 mm
    Precipitation - wettest quarter (Bio16) 1016.0 mm
    Radiation - annual mean (Bio20) 21.2 MJ/m2/day
    Radiation - seasonality (Bio23) 11.0
    Radiation - warmest quarter (Bio26) 23.8 MJ/m2/day
    Temperature - annual max mean 33.0625 degrees C
    Temperature - annual mean (Bio01) 28.2 degrees C
    Temperature - annual min mean 21.995834 degrees C
    Temperature - annual range 21.100006 degrees C
    Temperature - annual range (Bio07) 19.0 degrees C
    Temperature - coldest month min 17.62 degrees C
    Temperature - coldest period min (Bio06) 18.3 degrees C
    Temperature - coldest quarter mean (Bio11) 25.6 degrees C
    Temperature - diurnal range mean (Bio02) 11.4 degrees C
    Temperature - driest quarter mean (Bio09) 25.6 degrees C
    Temperature - isothermality (Bio03) 0.6 %
    Temperature - month hottest maximum 36.04 degrees C
    Temperature - seasonality (Bio04) 0.6
    Temperature - warmest month min 24.53 degrees C
    Temperature - warmest period max (Bio05) 37.4 degrees C
    Temperature - warmest quarter (Bio10) 30.3 degrees C
    Temperature - wettest quarter mean (Bio08) 28.9 degrees C
    Wind run - annual mean 95.06896 km/day
    WorldClim: Precipitation - annual 1462.0 mm
    WorldClim: Precipitation - coldest quarter 7.0 mm
    WorldClim: Precipitation - driest month 1.0 mm
    WorldClim: Precipitation - driest quarter 7.0 mm
    WorldClim: Precipitation - seasonality 110.0
    WorldClim: Precipitation - warmest quarter 371.0 mm
    WorldClim: Precipitation - wettest month 345.0 mm
    WorldClim: Precipitation - wettest quarter 983.0 mm
    WorldClim: Temperature - annual mean 279.0 degrees C * 10
    WorldClim: Temperature - annual range 185.0 degrees C * 10
    WorldClim: Temperature - coldest month min 182.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 253.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 115.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 253.0 degrees C * 10
    WorldClim: Temperature - isothermality 62.0 %
    WorldClim: Temperature - seasonality 1701.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 367.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 299.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 286.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.4101219 km x 100
    Distance - to non-permanent water (weighted) 0.17999999 degrees
    Distance - to permanent water (weighted) 0.0 km
    Euclidean Distance to Coast (metres) 41616.473 m
    Remoteness index 10.7424345
    Hydrology
    Drainage - average 2345.0 megalitres/5x5km/year
    Drainage - variability 27.0 %
    Runoff - average 12405.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) -0.1762053 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 80.99999
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 19.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.54 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 1.0 %
    Bulk density 1.192683 Mg/m^3
    Carbon - organic 0.3503403 %
    Clay % 9.164634 %
    Hydrologic conductivity - average saturated 188.88889 mm/h
    Moisture Index - annual mean (Bio28) 0.49
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.0 index
    Ph - soil 6.0 ph
    Soil depth 0.4 m
    Soil pedality 1.657317
    Water holding capacity 58000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 5.78397 Weathering Intensity Index
    Topography
    Aspect 90.0 degrees
    Averaged Topographic Relief 74.541664 metres
    Bathymetry and Elvation 9 sec 4.0 m
    Elevation 10.0 m
    Topographic Slope (degrees) 2.0630064 degrees
    Topographic relief 23.58919 m
    Topographic slope (%) 1.582455 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3838 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 38.0 %
    Gross Primary Productivity (2012-03-13) 0.0021 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.0 m^2 plant / m^2 ground
    NDVI Mean 62.0 NDVI x 100
    NPP Mean 5.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7058 NDVI