Occurrence record: BOLD - Australian records - 3547840

GenomicDNA of LEPIDOPTERA | Moths recorded on 2009-03-31

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3547840
Other catalog numbers recordID:1414006;ProcessID:GWORV335-10;sampleID:BC EF Alc 00759
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number BC EF Alc 00759
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Alc 00759
Record date 2009-03-31
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Northern Territory
Locality West Arnhem (S)
Locality East Alligator River
Latitude -12.4242
Longitude 132.964
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM911125
markercode COI-5P
nucleotides AACATTATATTTCATTTTTGGAATTTGAGCAGGAATAGTTGGAACTTCACTAAGTCTATTAATTCGAGCTGAATTAGGAAATCCTGGCTCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCATTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGTTTTGGTAATTGATTAGTTCCATTAATACTAGGAGCTCCTGATATAGCTTTCCCCCGAATAAATAATATAAGTTTTTGACTTCTACCCCCATCATTAACTTTATTAATCTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATGGAGGAACTTCAGTAGATCTAGCTATTTTTTCTTTACATTTAGCTGGTATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTCGATCAAATACCTTTATTTGTTTGAGCTGTAGGGATTACAGCATTCTTATTACTATTATCTTTACCAGTTTTAGCTGGAGCCATTACTATACTTCTAACTGATCGAAATTTAAATACATCTTTTTTTGATCCTGCTGGAGGAGGAGATCCTATTCTTTATCAACATTTATTT
Owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:19Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    CAPAD 2010 Terrestrial Kakadu
    CAPAD 2012 Terrestrial Kakadu
    CAPAD 2014 Terrestrial Kakadu National Park
    CAPAD 2016 Terrestrial Kakadu
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Important Bird Areas (IBA) Australia Kakadu Savanna IBA
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 Northern Territory
    NRM Regions 2014 Northern Territory
    NRM Regions 2015 Northern Territory
    NRM Regions 2017 Northern Territory
    NRM Regions 2017 (Qld 2019) Northern Territory
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Northern Territory
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Arnhem Plateau
    IBRA 6 Sub Regions Arnhem Plateau P1
    IBRA 7 Regions Arnhem Plateau
    IBRA 7 Subregions Alligator
    Terrestrial Ecoregional Boundaries Arnhem Land Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with plant growth determined by moisture availability
    Koppen Climate Classification (All Classes) Tropical: savanna
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    Hydrology
    Drainage Divisions Level 1 Tanami-Timor Sea Coast
    Drainage Divisions Level 2 EAST ALLIGATOR RIVER
    River Regions EAST ALLIGATOR RIVER
    Marine
    Marine Ecoregions of the World Arnhem Coast to Gulf of Carpenteria
    States including coastal waters Northern Territory (including Coastal Waters)
    Political
    ASGS Australian States and Territories Northern Territory
    Australian States and Territories Northern Territory
    Commonwealth Electoral Boundaries Lingiari
    Local Government Areas 2011 West Arnhem (S)
    Local Government Areas 2012 deprecated South Alligator
    Local Government Areas PSMA 2018 WEST ARNHEM REGION
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 206
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 485
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NT
    PSMA ABS SA2 Statistical Areas (2016) ALLIGATOR
    PSMA ABS SA3 Statistical Areas (2016) DALY - TIWI - WEST ARNHEM
    PSMA ABS SA4 Statistical Areas (2016) NORTHERN TERRITORY - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) LINGIARI
    PSMA Commonwealth Electoral Boundaries (2018) LINGIARI
    PSMA Indigenous Areas (2016) KAKADU - MARRAKAI - JABIRU
    PSMA Indigenous Locations (2016) KAKADU - MARRAKAI - SURROUNDS
    PSMA Indigenous Regions (2016) JABIRU - TIWI
    PSMA Localities (2018) KAKADU
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NT)
    PSMA State Electoral Boundaries (2016) ARAFURA
    PSMA State Electoral Boundaries (2018) ARAFURA
    PSMA States (2016) NORTHERN TERRITORY
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (NT)
    PSMA Wards (2018) KAKADU WARD
    Statistical Local Areas West Arnhem (S) Bal
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Pine Creek Region
    Surface Geology of Australia Lshe
    Topography
    Physiographic Provinces of Australia North Australian Plateaus Province
    Physiographic Regions 2011 Top End Coastal Plains
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous managed, Native forest
    Forests of Australia (2013) v2.0 Rainforest
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    NVIS 4.1 Major Vegetation Subgroups Dry rainforest or vine thickets
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Other grasslands,herblands, sedgelands and rushlands
    Vegetation types - present Other grasslands, herblands, sedgelands and rushlands

    Environmental sampling for this location

    Area Management
    Beef numbers 138656.0 dse
    Dairy numbers 0.0 dse
    Natural resource management expenditure 1.0309905E7 $
    Natural resource management expenditure - additional 0.0 $/ha
    Sheep numbers 0.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6754
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.7138
    Endemism 0.020854274
    Endemism (Non-marine) 0.02200965
    Mammals – Fritz et al 2009 - 0.5 degree 0.0
    Migratory species (2008) 9.0 frequency
    Occurrence Density 30887.0 frequency
    Shannon Diversity (H) 6.138294 index
    Species Richness 2234.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 6.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.6000783
    2030A1BMk35M: Aridity index - month max 2.094056
    2030A1BMk35M: Aridity index - month min 0.0
    2030A1BMk35M: Evaporation - annual mean 223.81958 mm
    2030A1BMk35M: Evaporation - month max 296.13 mm
    2030A1BMk35M: Evaporation - month min 165.54 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.38 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.05 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.39 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 61.581413 %
    2030A1BMk35M: Humidity - month max relative 3pm 75.84843 %
    2030A1BMk35M: Humidity - month min relative 3pm 51.87897 %
    2030A1BMk35M: Precipitation - annual mean 112.985 mm
    2030A1BMk35M: Precipitation - driest month 0.0 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.2703576
    2030A1BMk35M: Precipitation - max difference between successive months 5.086129 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -6.195742 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 1226.861
    2030A1BMk35M: Precipitation - spring or autumn season -2.6721895
    2030A1BMk35M: Precipitation - summer or winter season 513.1511
    2030A1BMk35M: Precipitation - wettest month 347.18 mm
    2030A1BMk35M: Precipitation deficit - annual mean -110.83459 mm
    2030A1BMk35M: Precipitation deficit - month max -283.46 mm
    2030A1BMk35M: Precipitation deficit - month min 181.11 mm
    2030A1BMk35M: Radiation - max month precipitation modified 26.42 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 21.353333 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 18.09 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 34.927498 degrees C
    2030A1BMk35M: Temperature - annual min mean 23.436666 degrees C
    2030A1BMk35M: Temperature - annual range 18.649994 degrees C
    2030A1BMk35M: Temperature - coldest month min 19.36 degrees C
    2030A1BMk35M: Temperature - coolest month max 32.57 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.1599731 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.600006 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 14.47998 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 11.490829 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.8099976 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.380005 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 8.209991 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 38.01 degrees C
    2030A1BMk35M: Temperature - warmest month min 25.92 degrees C
    Aridity index - annual mean 0.67362016
    Aridity index - month max 2.1857085
    Aridity index - month min 0.0053908355
    Evaporation - annual mean 182.61696 (ml/5km x 5km pixel)
    Evaporation - average 23445.0 ml
    Evaporation - month max 237.8 mm
    Evaporation - month min 143.83069 mm
    Evaporation - variability 9.0 %
    Growth index C3 macrotherm plants - annual mean 0.44 index
    Growth index C3 mesotherm plants - annual mean 0.13 index
    Growth index C4 megatherm plants - annual mean 0.42 index
    Humidity - annual mean relative 79.30318 %
    Humidity - annual mean relative 3pm 60.731556 %
    Humidity - month max relative 88.6614 %
    Humidity - month max relative 3pm 75.01478 %
    Humidity - month min relative 51.01507 %
    Humidity - month min relative 3pm 51.01507 %
    Precipitation - annual 1348.0 mm
    Precipitation - annual (Bio12) 1475.0 mm
    Precipitation - annual (log) seasonality index 0.5729053
    Precipitation - annual mean 111.58875 mm
    Precipitation - annual seasonality 12.420054
    Precipitation - annual seasonality ratio 13.555055
    Precipitation - autumn 347.0 mm
    Precipitation - autumn reliability 24.0 %
    Precipitation - coldest quarter (Bio19) 4.0 mm
    Precipitation - driest month 1.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 3.0 mm
    Precipitation - equinox seasonality ratio 0.39854336
    Precipitation - max difference between successive months 3.4403384 mm/day
    Precipitation - min difference between successive months -6.2139783 mm/day
    Precipitation - seasonality (Bio15) 115.0 mm
    Precipitation - solstice seasonality ratio 212.09299
    Precipitation - spring 138.0 mm
    Precipitation - spring or autumn (log) season -0.18536974
    Precipitation - spring or autumn season -1.4983342
    Precipitation - spring reliability 27.0 %
    Precipitation - summer 846.0 mm
    Precipitation - summer or winter (log) season 3.1905918
    Precipitation - summer or winter season 168.87439
    Precipitation - summer reliability 85.0 %
    Precipitation - warmest quarter (Bio18) 363.0 mm
    Precipitation - wettest month 314.37198 mm
    Precipitation - wettest period (Bio13) 93.0 mm
    Precipitation - wettest quarter (Bio16) 1016.0 mm
    Precipitation - winter 2.0 mm
    Precipitation - winter reliability 1.0 %
    Precipitation deficit - annual mean -71.028206 mm
    Precipitation deficit - month max -214.8 mm
    Precipitation deficit - month min 170.54129 mm
    Radiation - annual mean (Bio20) 21.2 MJ/m2/day
    Radiation - coldest quarter (Bio27) 19.3 MJ/m2/day
    Radiation - driest quarter (Bio25) 19.6 MJ/m2/day
    Radiation - highest period (Bio21) 26.0 MJ/m2/day
    Radiation - lowest period (Bio22) 17.9 MJ/m2/day
    Radiation - max month precipitation modified 25.8 MJ/m2/day
    Radiation - mean annual precipitation modified 21.258333 MJ/m2/day
    Radiation - min month precipitation modified 18.1 MJ/m2/day
    Radiation - seasonality (Bio23) 11.0
    Radiation - warmest quarter (Bio26) 23.8 MJ/m2/day
    Radiation - wettest quarter (Bio24) 20.1 MJ/m2/day
    Temperature - annual max mean 33.0625 degrees C
    Temperature - annual mean (Bio01) 28.2 degrees C
    Temperature - annual min mean 21.995834 degrees C
    Temperature - annual range 21.100006 degrees C
    Temperature - annual range (Bio07) 19.0 degrees C
    Temperature - coldest month min 17.62 degrees C
    Temperature - coldest period min (Bio06) 18.3 degrees C
    Temperature - coldest quarter mean (Bio11) 25.6 degrees C
    Temperature - coolest month max 30.71 degrees C
    Temperature - diurnal range mean (Bio02) 11.4 degrees C
    Temperature - driest quarter mean (Bio09) 25.6 degrees C
    Temperature - isothermality (Bio03) 0.6 %
    Temperature - max absolute mean max 42.0 degrees C
    Temperature - max difference in max 1.8900146 degrees C/day
    Temperature - max difference in min 2.3199768 degrees C/day
    Temperature - max month diurnal range 13.829987 degrees C
    Temperature - mean annual absolute mean min 12.986583 degrees C
    Temperature - mean annual diurnal range 11.066666 degrees C
    Temperature - min absolute mean min 4.5 degrees C
    Temperature - min difference in max -1.7000122 degrees C/day
    Temperature - min difference in min -2.600006 degrees C/day
    Temperature - min month diurnal range 8.160004 degrees C
    Temperature - month hottest maximum 36.04 degrees C
    Temperature - month mean absolute max 38.902416 degrees C
    Temperature - seasonality (Bio04) 0.6
    Temperature - warmest month min 24.53 degrees C
    Temperature - warmest period max (Bio05) 37.4 degrees C
    Temperature - warmest quarter (Bio10) 30.3 degrees C
    Temperature - wettest quarter mean (Bio08) 28.9 degrees C
    Vapour pressure deficit - annual mean 0.96071905 KPa
    Vapour pressure deficit - annual mean 9am 1.0600948 KPa
    Vapour pressure deficit - month max 1.5230052 KPa
    Vapour pressure deficit - month max 9am 1.4331763 KPa
    Vapour pressure deficit - month min 0.5175774 KPa
    Vapour pressure deficit - month min 9am 0.6497035 KPa
    Wind run - annual mean 95.06896 km/day
    Wind run - month max 114.6352 km/day
    Wind run - month min 78.20505 km/day
    Wind speed - annual mean 3pm 2.725 m/s
    Wind speed - annual mean 9am 1.4127427 m/s
    Wind speed - annual mean 9am or 3pm 2.75 m/s
    Wind speed - month max 3pm 3.4 m/s
    Wind speed - month max 9am 2.1 m/s
    Wind speed - month max 9am or 3pm 3.4 m/s
    Wind speed - month min 3pm 2.1 m/s
    Wind speed - month min 9am 1.1 m/s
    Wind speed - month min 9am or 3pm 1.1 m/s
    WorldClim: Precipitation - annual 1462.0 mm
    WorldClim: Precipitation - coldest quarter 7.0 mm
    WorldClim: Precipitation - driest month 1.0 mm
    WorldClim: Precipitation - driest quarter 7.0 mm
    WorldClim: Precipitation - seasonality 110.0
    WorldClim: Precipitation - warmest quarter 371.0 mm
    WorldClim: Precipitation - wettest month 345.0 mm
    WorldClim: Precipitation - wettest quarter 983.0 mm
    WorldClim: Temperature - annual mean 279.0 degrees C * 10
    WorldClim: Temperature - annual range 185.0 degrees C * 10
    WorldClim: Temperature - coldest month min 182.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 253.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 115.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 253.0 degrees C * 10
    WorldClim: Temperature - isothermality 62.0 %
    WorldClim: Temperature - seasonality 1701.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 367.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 299.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 286.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.4101219 km x 100
    Distance - to non-permanent water (weighted) 0.17999999 degrees
    Distance - to permanent water (weighted) 0.0 km
    Euclidean Distance to Coast (metres) 41616.473 m
    Remoteness index 10.7424345
    Hydrology
    Drainage - average 2345.0 megalitres/5x5km/year
    Drainage - variability 27.0 %
    Runoff - average 12405.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Age 34.277378 years
    Age - prime group 37.607304 Count
    Disadvantaged 983.431 points (mean=1000)
    Education - degrees 6.234745 %
    Education - vocational training 23.127308 %
    Employment 21.631544 %
    Home ownership 38.18936 %
    Income - high 15.205681 %
    Income - low 19.478548 %
    Internet 15.00248 %
    Population - change -11.830372 count
    Population - density SLA 2006 p/sqkm) -0.1762053 people/km^2
    Unemployment rate 4.673141 %
    Work force - older 25.426136 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.40035716
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.0
    2030A1BMk35M: Water deficit - month max 148.16475 mm
    2030A1BMk35M: Water deficit - month mean 32.606834 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.125 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 36.032143
    2030A1BMk35M: Water stress index - month max 80.99999
    2030A1BMk35M: Water stress index - month min 0.0
    2030A1BMk35M: Water surplus - annual mean 33.980167 mm
    2030A1BMk35M: Water surplus - month max 197.664 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 19.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.54 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 1.0 %
    Bouguer gravity anomalies 571.0404 Gal
    Bulk density 1.192683 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.3503403 %
    Carbon store pre-European 33.79972 kgC/ha
    Clay % 9.164634 %
    Crop factor - annual mean 0.43556955
    Crop factor - month max 0.90000004
    Crop factor - month min 0.0053908355
    Erodibility 90.0 k factor
    Erosional surfaces - proportion 93.75 %
    Erosivity 11653.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 188.88889 mm/h
    Hydrological conductivity - uncertainty 21.11111
    Lithology - age range 200.0 my
    Lithology - fertility 3.0 index
    Lithology - mean age 1700.0 my
    Lithology - mean age (log) 3.230449 log my
    Lithology - mean age range (log) 2.30103 log my
    Magnetic anomalies -22.0 nT
    Moisture - average 44.0 %
    Moisture - variability 10.0 %
    Moisture Index - annual mean (Bio28) 0.49
    Moisture Index - coldest quarter mean (Bio35) 0.01
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.0
    Moisture Index - lowest quarter mean (Bio33) 0.01
    Moisture Index - seasonality (Bio31) 90.0
    Moisture Index - warmest quarter mean (Bio34) 0.46
    Nitrogen - plant-available pre-European 2909.567 kgN/ha
    Nitrogen concentration pre-European 23.36668 mgN kg/H2O
    Nitrogen store pre-European 28.32729 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 1.657317
    Ph - soil 6.0 ph
    Phosphorus - plant-available pre-European 5.139987 kgP/ha
    Phosphorus - plant-available total pre-European 411.87823 kgP/ha
    Phosphorus pre-European 4.239883 mgP kg/H2O
    Soil depth 0.4 m
    Soil pedality 1.657317
    Soils - coarse 0.0 class
    Substrate data reliability 3.0
    Topographic wetness index 14.16108
    Unreliable water retention parameters 0.0
    Water deficit - month max 112.0851 mm
    Water deficit - month mean 24.808857 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 58000.0 mm
    Water holding capacity - plant-available 85.0 mm
    Water potential - annual mean -1.0136852 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 39.20126
    Water stress index - month max 81.0
    Water stress index - month min 0.4851752
    Water surplus - annual mean 36.554127 mm
    Water surplus - month max 184.92438 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 5.78397 Weathering Intensity Index
    Topography
    Aspect 90.0 degrees
    Averaged Topographic Relief 74.541664 metres
    Bathymetry and Topography 9 sec 4.0 m
    Elevation 10.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 2.0630064 degrees
    Topographic relief 23.58919 m
    Topographic roughness 99.20683 %
    Topographic slope (%) 1.582455 %
    Valley bottom % 31.25 %
    Valley bottom flatness index 1.906504
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3838 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 38.0 %
    Gross Primary Productivity (2012-03-13) 0.0021 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.0 m^2 plant / m^2 ground
    NDVI Mean 62.0 NDVI x 100
    NPP Mean 5.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7058 NDVI
    Phenology peak day of year 2002 dry 44.2 Day
    Phenology peak day of year 2012 wet 20.2 Day