Occurrence record: BOLD - Australian records - 2853891

GenomicDNA of CHARADRIIFORMES | Waders, Gulls and Terns, Auks recorded on 1985-12-09

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 2853891
Other catalog numbers recordID:279722;ProcessID:ROMC036-06;sampleID:MKP 235
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Baker, A.J.|Peck, M.K.
Supplied as "A. J. Baker, M.K. Peck"
Sex male
Life stage adult
License CC-BY-Int
Field number MKP 235
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number MKP 235
Record date 1985-12-09
Date precision Day

Taxonomy

Scientific name CHARADRIIFORMES
Taxon rank order
Common name Waders, Gulls and Terns, Auks
Kingdom Animalia
Phylum Chordata
Class Aves
Order Charadriiformes
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Victoria
Locality Mornington Peninsula (S)
Locality Corinella Pen, Western Port Bay
Latitude -38.2452
Longitude 145.253
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

markercode COI-5P
nucleotides ATGACATTCATCAACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATACCTAATCTTTGGTGCATGAGCCGGTATAGTCGGTACCGCCCTCAGCTTACTCATCCGCGCAGAACTAGGTCAACCAGGAACCCTGCTAGGAGATGACCAAATTTACAATGTAATCGTCACGGCCCACGCCTTCGTGATAATCTTCTTCATAGTTATACCGATTATGATCGGCGGATTCGGAAACTGACTAGTCCCGCTCATAATCGGTGCTCCAGACATAGCATTCCCCCGCATGAACAACATAAGCTTCTGACTACTACCCCCATCATTCCTTCTCCTCCTTGCCTCCTCTACAGTAGAAGCAGGGGCAGGCACAGGATGAACCGTATACCCCCCTCTAGCTGGCAACCTCGCCCATGCTGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTTCACCTGGCAGGTGTATCCTCCATCCTGGGTGCAATCAACTTTATCACAACCGCCATCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCCCTATTTGTATGATCCGTACTCATTACCGCCGTCCTACTACTCCTATCCCTCCCAGTCCTTGCTGCCGGCATCACAATACTCCTAACAGACCGGAATCTAAACACTACATTCTTCGACCCTGCTGGAGGCGGTGACCCCGTCCTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTACCAGGCTTCGGAATCATCTCCCACGTGGTAACATACTACGCAGGGAAAAAAGAACCATTTGGCTATATAGGAATAGTATGAGCCATACTATCAATTGGATTCTTAGGCTTTATCGTCTGAGCTCACCACATATTCACAGTAGGAATAGACGTAGAC
Owner institution code Royal Ontario Museum
sequence last updated 2011-11-14T08:11:23Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial North Western Port N.C.R.
    CAPAD 2012 Terrestrial North Western Port N.C.R.
    CAPAD 2014 Terrestrial North Western Port N.C.R.
    CAPAD 2016 Terrestrial North Western Port N.C.R.
    Directory of Important Wetlands Western Port
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Important Bird Areas (IBA) Australia Western Port IBA
    NRM Regions 2010 Port Phillip and Western Port
    NRM Regions 2014 Port Phillip and Western Port
    NRM Regions 2015 Port Phillip and Western Port
    NRM Regions 2017 Port Phillip and Western Port
    NRM Regions 2017 (Qld 2019) Port Phillip and Western Port
    Area management
    National Landcare Program Management Units 2018 Port Phillip and Western Port
    Biodiversity
    IMCRA 4 Regions Bass Strait Shelf Province
    IMCRA Meso-scale Bioregions Victorian Embayments
    World Anthropogenic Biomes (2000) Residential rangelands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Marine
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Marine Ecoregions of the World Bassian
    States including coastal waters Victoria (including Coastal Waters)
    Political
    ASGS Australian States and Territories Victoria
    Australian States and Territories Victoria
    Commonwealth Electoral Boundaries Flinders
    Local Government Areas 2011 Mornington Peninsula (S)
    Local Government Areas 2012 deprecated Mornington P'sula - East
    Local Government Areas PSMA 2018 MORNINGTON PENINSULA SHIRE
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 18
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1305
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER MELBOURNE
    PSMA ABS SA2 Statistical Areas (2016) SOMERVILLE
    PSMA ABS SA3 Statistical Areas (2016) MORNINGTON PENINSULA
    PSMA ABS SA4 Statistical Areas (2016) MORNINGTON PENINSULA
    PSMA Commonwealth Electoral Boundaries (2016) FLINDERS
    PSMA Commonwealth Electoral Boundaries (2018) FLINDERS
    PSMA Indigenous Areas (2016) MORNINGTON PENINSULA
    PSMA Indigenous Locations (2016) MORNINGTON - EAST
    PSMA Indigenous Regions (2016) MELBOURNE
    PSMA Localities (2018) SOMERVILLE
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) MELBOURNE
    PSMA State Electoral Boundaries (2016) HASTINGS
    PSMA State Electoral Boundaries (2018) HASTINGS
    PSMA States (2016) VICTORIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (VIC.)
    PSMA Wards (2018) WATSON WARD
    Statistical Local Areas Mornington P'sula (S) - East
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Gippsland Region
    Surface Geology of Australia Qrc
    NVIS 4.1 Major Vegetation Subgroups Saline or brackish sedgelands or grasslands

    Environmental sampling for this location

    Area Management
    Beef numbers 85455.0 dse
    Dairy numbers 139.0 dse
    Natural resource management expenditure 3839264.0 $
    Sheep numbers 1689.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8062
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.2403
    Endemism 0.020425575
    Endemism (Non-marine) 0.023695389
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 18.0 frequency
    Occurrence Density 23892.0 frequency
    Shannon Diversity (H) 6.1337423 index
    Species Richness 2101.0 frequency
    Threatened species (2008) 8.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.7198751
    2030A1BMk35M: Aridity index - month max 1.5070517
    2030A1BMk35M: Aridity index - month min 0.23839086
    2030A1BMk35M: Evaporation - annual mean 103.97871 mm
    2030A1BMk35M: Evaporation - month max 177.6011 mm
    2030A1BMk35M: Evaporation - month min 46.245556 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.1 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.4 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.06 index
    2030A1BMk35M: Precipitation - annual mean 57.849724 mm
    2030A1BMk35M: Precipitation - driest month 37.162224 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1715673
    2030A1BMk35M: Precipitation - max difference between successive months 0.518619 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.46661055 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.6663433
    2030A1BMk35M: Precipitation - spring or autumn season 0.17053388
    2030A1BMk35M: Precipitation - summer or winter season -0.49702707
    2030A1BMk35M: Precipitation - wettest month 69.905556 mm
    2030A1BMk35M: Precipitation deficit - annual mean -46.128983 mm
    2030A1BMk35M: Precipitation deficit - month max -132.73221 mm
    2030A1BMk35M: Precipitation deficit - month min 23.448887 mm
    2030A1BMk35M: Radiation - max month precipitation modified 24.881111 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 15.187037 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 5.768889 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 20.47574 degrees C
    2030A1BMk35M: Temperature - annual min mean 10.764814 degrees C
    2030A1BMk35M: Temperature - annual range 19.814453 degrees C
    2030A1BMk35M: Temperature - coldest month min 6.9355555 degrees C
    2030A1BMk35M: Temperature - coolest month max 14.438889 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.3966675 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.5677795 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 11.847778 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.71093 degrees C
    2030A1BMk35M: Temperature - min difference in max -3.2688904 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.4444275 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 7.503357 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 26.75 degrees C
    2030A1BMk35M: Temperature - warmest month min 14.902222 degrees C
    Precipitation - annual (Bio12) 773.6667 mm
    Precipitation - autumn reliability 47.0 %
    Precipitation - coldest quarter (Bio19) 229.66667 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 134.33333 mm
    Precipitation - seasonality (Bio15) 21.0 mm
    Precipitation - spring or autumn season 0.124115884
    Precipitation - spring reliability 69.0 %
    Precipitation - summer reliability 42.0 %
    Precipitation - warmest quarter (Bio18) 138.0 mm
    Precipitation - wettest period (Bio13) 19.666666 mm
    Precipitation - wettest quarter (Bio16) 239.66667 mm
    Precipitation - winter reliability 81.0 %
    Precipitation deficit - annual mean -38.0101 mm
    Precipitation deficit - month max -150.61777 mm
    Radiation - annual mean (Bio20) 15.0 MJ/m2/day
    Radiation - coldest quarter (Bio27) 7.3 MJ/m2/day
    Radiation - driest quarter (Bio25) 21.2 MJ/m2/day
    Radiation - highest period (Bio21) 25.2 MJ/m2/day
    Radiation - lowest period (Bio22) 5.4666667 MJ/m2/day
    Radiation - seasonality (Bio23) 46.0
    Radiation - warmest quarter (Bio26) 22.6 MJ/m2/day
    Radiation - wettest quarter (Bio24) 11.9 MJ/m2/day
    Temperature - annual mean (Bio01) 14.6 degrees C
    Temperature - annual range (Bio07) 19.866667 degrees C
    Temperature - coldest period min (Bio06) 5.9333334 degrees C
    Temperature - coldest quarter mean (Bio11) 10.3 degrees C
    Temperature - diurnal range mean (Bio02) 9.433333 degrees C
    Temperature - driest quarter mean (Bio09) 18.9 degrees C
    Temperature - isothermality (Bio03) 0.47333333 %
    Temperature - seasonality (Bio04) 1.18
    Temperature - warmest period max (Bio05) 25.8 degrees C
    Temperature - warmest quarter (Bio10) 19.0 degrees C
    Temperature - wettest quarter mean (Bio08) 11.8 degrees C
    Wind run - annual mean 329.36093 km/day
    Wind run - month max 381.9252 km/day
    Wind run - month min 287.61237 km/day
    Wind speed - annual mean 3pm 5.937492 m/s
    Wind speed - annual mean 9am 5.519037 m/s
    Wind speed - annual mean 9am or 3pm 6.267847 m/s
    Wind speed - month max 3pm 6.4214206 m/s
    Wind speed - month max 9am 6.114273 m/s
    Wind speed - month max 9am or 3pm 6.4214206 m/s
    Wind speed - month min 3pm 5.4571366 m/s
    Wind speed - month min 9am 4.885705 m/s
    Wind speed - month min 9am or 3pm 4.885705 m/s
    Distance
    Distance - to any water (weighted) 0.06 degrees
    Distance - to coast 0.0 km x 100
    Distance - to non-permanent water (weighted) 0.20124611 degrees
    Distance - to permanent water (weighted) 0.06 km
    Euclidean Distance to Coast (metres) 992.5399 m
    Remoteness index 0.20122328
    Hydrology
    Water Observations From Space 0.7751938 Percentage
    Marine
    Sea Surface Temperature - MODIS Terra 14.406743 Degrees C
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.6582896
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.23839086
    2030A1BMk35M: Water deficit - month max 101.90188 mm
    2030A1BMk35M: Water deficit - month mean 31.416685 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.85458505 MPa
    2030A1BMk35M: Water potential - month max -0.01094405 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 59.24606
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 21.455175
    2030A1BMk35M: Water surplus - annual mean 0.0 mm
    2030A1BMk35M: Water surplus - month max 0.0 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 144.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.3 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 5.0 %
    Bouguer gravity anomalies 92.22276 Gal
    Bulk density 0.9304 Mg/m^3
    Calcrete 0.0 presence
    Carbon store pre-European 79.37688 kgC/ha
    Clay % 14.0 %
    Erodibility 23.0 k factor
    Erosional surfaces - proportion 0.0 %
    Erosivity 1022.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 166.66667 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 2.588 my
    Lithology - fertility 2.0 index
    Lithology - mean age 1.294 my
    Lithology - mean age (log) 0.11193429 log my
    Lithology - mean age range (log) 0.41296428 log my
    Magnetic anomalies 2.0 nT
    Moisture Index - annual mean (Bio28) 0.71
    Moisture Index - coldest quarter mean (Bio35) 0.97
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.23
    Moisture Index - lowest quarter mean (Bio33) 0.27
    Moisture Index - seasonality (Bio31) 43.0
    Moisture Index - warmest quarter mean (Bio34) 0.29
    Nitrogen - plant-available pre-European 6803.77 kgN/ha
    Nitrogen concentration pre-European 54.46168 mgN kg/H2O
    Nitrogen store pre-European 130.69 kgN/ha
    Nutrient status 1.4 index
    Pedality hydrological score 2.12
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 24.04802 kgP/ha
    Phosphorus - plant-available total pre-European 1405.0876 kgP/ha
    Phosphorus pre-European 10.02139 mgP kg/H2O
    Soil depth 0.6 m
    Soil pedality 2.12
    Soils - coarse 0.0 class
    Substrate data reliability 3.0
    Topographic wetness index 6.76868
    Unreliable water retention parameters 16.666666
    Water holding capacity 37000.0 mm
    Water holding capacity - plant-available 71.0 mm
    Weathering Intensity V2 6.30142 Weathering Intensity Index
    Topography
    Aspect 115.0 degrees
    Averaged Topographic Relief 45.208332 metres
    Bathymetry and Topography 9 sec 0.0 m
    Elevation 0.0 m
    Ridge top flatness 1.864779
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 0.19207352 degrees
    Topographic relief 0.2683331 m
    Topographic roughness 11.28534 %
    Topographic slope (%) 0.06351104 %
    Valley bottom % 25.0 %
    Valley bottom flatness index 3.973716
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.0584 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 43.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 33.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 67.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.7 m^2 plant / m^2 ground
    NDVI Mean 73.0 NDVI x 100
    NPP Mean 16.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3673 NDVI
    Phenology peak day of year 2002 dry 205.0 Day
    Phenology peak day of year 2012 wet 243.22223 Day