Occurrence record: BOLD - Australian records - 2853891

GenomicDNA of CHARADRIIFORMES | Waders, Gulls and Terns, Auks recorded on 1985-12-09

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 2853891
Other catalogue numbers recordID:279722;ProcessID:ROMC036-06;sampleID:MKP 235
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Baker, A.J.|Peck, M.K.
Supplied as "A. J. Baker, M.K. Peck"
Sex male
Life stage adult
License CC-BY-Int
Field number MKP 235
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number MKP 235
Record date 1985-12-09
Date precision Day

Taxonomy

Scientific name CHARADRIIFORMES
Taxon rank order
Common name Waders, Gulls and Terns, Auks
Kingdom Animalia
Phylum Chordata
Class Aves
Order Charadriiformes
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Victoria
Local government area Mornington Peninsula (S)
Locality Corinella Pen, Western Port Bay
Latitude -38.2452
Longitude 145.253
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

markercode COI-5P
nucleotides ATGACATTCATCAACCGATGATTATTCTCAACCAACCACAAAGACATCGGTACCCTATACCTAATCTTTGGTGCATGAGCCGGTATAGTCGGTACCGCCCTCAGCTTACTCATCCGCGCAGAACTAGGTCAACCAGGAACCCTGCTAGGAGATGACCAAATTTACAATGTAATCGTCACGGCCCACGCCTTCGTGATAATCTTCTTCATAGTTATACCGATTATGATCGGCGGATTCGGAAACTGACTAGTCCCGCTCATAATCGGTGCTCCAGACATAGCATTCCCCCGCATGAACAACATAAGCTTCTGACTACTACCCCCATCATTCCTTCTCCTCCTTGCCTCCTCTACAGTAGAAGCAGGGGCAGGCACAGGATGAACCGTATACCCCCCTCTAGCTGGCAACCTCGCCCATGCTGGAGCTTCAGTAGACCTAGCCATCTTCTCCCTTCACCTGGCAGGTGTATCCTCCATCCTGGGTGCAATCAACTTTATCACAACCGCCATCAACATAAAACCACCTGCCCTCTCACAATACCAAACCCCCCTATTTGTATGATCCGTACTCATTACCGCCGTCCTACTACTCCTATCCCTCCCAGTCCTTGCTGCCGGCATCACAATACTCCTAACAGACCGGAATCTAAACACTACATTCTTCGACCCTGCTGGAGGCGGTGACCCCGTCCTATACCAACACCTTTTCTGATTCTTCGGCCACCCAGAAGTCTACATTCTAATCCTACCAGGCTTCGGAATCATCTCCCACGTGGTAACATACTACGCAGGGAAAAAAGAACCATTTGGCTATATAGGAATAGTATGAGCCATACTATCAATTGGATTCTTAGGCTTTATCGTCTGAGCTCACCACATATTCACAGTAGGAATAGACGTAGAC
owner institution code Royal Ontario Museum
sequence last updated 2011-11-14T08:11:23Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial North Western Port N.C.R.
    CAPAD 2012 Terrestrial North Western Port N.C.R.
    CAPAD 2014 Terrestrial North Western Port N.C.R.
    CAPAD 2016 Terrestrial North Western Port N.C.R.
    Directory of Important Wetlands Western Port
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Important Bird Areas (IBA) Australia Western Port IBA
    NRM Regions 2010 Port Phillip and Western Port
    NRM Regions 2014 Port Phillip and Western Port
    NRM Regions 2015 Port Phillip and Western Port
    NRM Regions 2017 Port Phillip and Western Port
    NRM Regions 2017 (Qld 2019) Port Phillip and Western Port
    Area management
    National Landcare Program Management Units 2018 Port Phillip and Western Port
    Biodiversity
    IMCRA 4 Regions Bass Strait Shelf Province
    IMCRA Meso-scale Bioregions Victorian Embayments
    World Anthropogenic Biomes (2000) Residential rangelands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Marine
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Marine Ecoregions of the World Bassian
    States including coastal waters Victoria (including Coastal Waters)
    Political
    ASGS Australian States and Territories Victoria
    Australian States and Territories Victoria
    Commonwealth Electoral Boundaries Flinders
    Local Government Areas 2011 Mornington Peninsula (S)
    Local Government Areas 2012 deprecated Mornington P'sula - East
    Local Government Areas PSMA 2018 MORNINGTON PENINSULA SHIRE
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 18
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1305
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER MELBOURNE
    PSMA ABS SA2 Statistical Areas (2016) SOMERVILLE
    PSMA ABS SA3 Statistical Areas (2016) MORNINGTON PENINSULA
    PSMA ABS SA4 Statistical Areas (2016) MORNINGTON PENINSULA
    PSMA Commonwealth Electoral Boundaries (2016) FLINDERS
    PSMA Commonwealth Electoral Boundaries (2018) FLINDERS
    PSMA Indigenous Areas (2016) MORNINGTON PENINSULA
    PSMA Indigenous Locations (2016) MORNINGTON - EAST
    PSMA Indigenous Regions (2016) MELBOURNE
    PSMA Localities (2018) SOMERVILLE
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) MELBOURNE
    PSMA State Electoral Boundaries (2016) HASTINGS
    PSMA State Electoral Boundaries (2018) HASTINGS
    PSMA States (2016) VICTORIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (VIC.)
    PSMA Wards (2018) WATSON WARD
    Statistical Local Areas Mornington P'sula (S) - East
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Gippsland Region
    Surface Geology of Australia Qrc
    NVIS 4.1 Major Vegetation Subgroups Saline or brackish sedgelands or grasslands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 3839264.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8062
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.2403
    Endemism 0.020425575
    Endemism (Non-marine) 0.023695389
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 18.0 frequency
    Occurrence Density 23892.0 frequency
    Shannon Diversity (H) 6.1337423 index
    Species Richness 2101.0 frequency
    Threatened species (2008) 8.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.7198751
    2030A1BMk35M: Evaporation - month min 46.245556 mm
    2030A1BMk35M: Precipitation - annual mean 57.849724 mm
    2030A1BMk35M: Precipitation - driest month 37.162224 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1715673
    2030A1BMk35M: Precipitation - spring or autumn season 0.17053388
    2030A1BMk35M: Temperature - annual max mean 20.47574 degrees C
    2030A1BMk35M: Temperature - annual min mean 10.764814 degrees C
    2030A1BMk35M: Temperature - annual range 19.814453 degrees C
    Precipitation - annual (Bio12) 773.6667 mm
    Precipitation - coldest quarter (Bio19) 229.66667 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 134.33333 mm
    Precipitation - seasonality (Bio15) 21.0 mm
    Precipitation - spring or autumn season 0.124115884
    Precipitation - warmest quarter (Bio18) 138.0 mm
    Precipitation - wettest period (Bio13) 19.666666 mm
    Precipitation - wettest quarter (Bio16) 239.66667 mm
    Radiation - annual mean (Bio20) 15.0 MJ/m2/day
    Radiation - seasonality (Bio23) 46.0
    Radiation - warmest quarter (Bio26) 22.6 MJ/m2/day
    Temperature - annual mean (Bio01) 14.6 degrees C
    Temperature - annual range (Bio07) 19.866667 degrees C
    Temperature - coldest period min (Bio06) 5.9333334 degrees C
    Temperature - coldest quarter mean (Bio11) 10.3 degrees C
    Temperature - diurnal range mean (Bio02) 9.433333 degrees C
    Temperature - driest quarter mean (Bio09) 18.9 degrees C
    Temperature - isothermality (Bio03) 0.47333333 %
    Temperature - seasonality (Bio04) 1.18
    Temperature - warmest period max (Bio05) 25.8 degrees C
    Temperature - warmest quarter (Bio10) 19.0 degrees C
    Temperature - wettest quarter mean (Bio08) 11.8 degrees C
    Wind run - annual mean 329.36093 km/day
    Distance
    Distance - to any water (weighted) 0.06 degrees
    Distance - to coast 0.0 km x 100
    Distance - to non-permanent water (weighted) 0.20124611 degrees
    Distance - to permanent water (weighted) 0.06 km
    Euclidean Distance to Coast (metres) 992.5399 m
    Remoteness index 0.20122328
    Hydrology
    Water Observations From Space 0.7751938 Percentage
    Marine
    Sea Surface Temperature - MODIS Terra 14.406743 Degrees C
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 144.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.3 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 5.0 %
    Bulk density 0.9304 Mg/m^3
    Clay % 14.0 %
    Hydrologic conductivity - average saturated 166.66667 mm/h
    Moisture Index - annual mean (Bio28) 0.71
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.4 index
    Ph - soil 4.0 ph
    Soil depth 0.6 m
    Soil pedality 2.12
    Water holding capacity 37000.0 mm
    Weathering Intensity V2 6.30142 Weathering Intensity Index
    Topography
    Aspect 115.0 degrees
    Averaged Topographic Relief 45.208332 metres
    Bathymetry and Elvation 9 sec 0.0 m
    Elevation 0.0 m
    Topographic Slope (degrees) 0.19207352 degrees
    Topographic relief 0.2683331 m
    Topographic slope (%) 0.06351104 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.0584 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 43.0 %
    Fractional Cover - Bare Soil (2012-03-05) 0.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 33.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 67.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.7 m^2 plant / m^2 ground
    NDVI Mean 73.0 NDVI x 100
    NPP Mean 16.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3673 NDVI