Occurrence record: Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment - EUK-1058
Dataset
Data resource | Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment |
Catalog number | EUK-1058 |
Record type |
Material Sample
Supplied basis "MaterialSample" |
License | CC-BY 4.0 (Int) |
Associated references | https://www.nature.com/articles/s41598-017-12501-5 |
Presence/Absence | PRESENT Supplied as present |
Associated sequences | https://datadryad.org/resource/doi:10.5061/dryad.qq11c |
Event
Occurrence date |
2015-03-17
Supplied date "17/03/2015" |
Date precision | DAY |
Taxonomy
Scientific name | Pseudotontonia |
Identified to rank | genus |
Kingdom |
Protista
Supplied as "Chromista" |
Phylum | Ciliophora |
Class |
Oligotrichea
Supplied as "Spirotrichea" |
Order | Oligotrichida |
Family |
Tontoniidae
Supplied as "Totoniidae" |
Genus | Pseudotontonia |
Name match metric | exactMatch |
Name parse type | SCIENTIFIC |
Geospatial
Country | Australia |
State or Territory | Western Australia |
Locality | Australia, West Australia, Coral Bay |
Habitat |
Supplied as "coral reef" |
Latitude |
-23.154793 Supplied as: "-23.154793" |
Longitude |
113.766328 Supplied as: "113.766328" |
Datum | EPSG:4326 |
Coordinate precision | Unknown |
Terrestrial | true |
Biome | TERRESTRIAL |
Marine | false |
Country Code | AU |
Depth | 0.5 |
Additional properties
alt elev | sea level |
biotic relationship | environmental |
chimera check | Perseus |
collection date | 17/03/2015 |
data type comment | You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/ |
env biome | coral reef |
env feature | ocean |
env material | seawater |
env package | seawater |
experimental factor | environmental DNA survey |
geo loc name | Australia, West Australia, Coral Bay |
investigation type | survey, eukaryotes |
lat lon | -23.154793_113.766328 |
lib const meth | Illumina paired-end sequencing |
lib reads seqd | 275067 |
nucl acid ext | Qiagen Dneasy Blood & Tissue Kit |
pcr cond | initial denaturation at 95°C for 5 min, followed by 40 cycles of 30 s at 95°C, 30 s at 52, 58, or 64°C and 45 s at 72°C, with a final extension for 10 min at 72°C |
pcr primers | 5’ GCCAGTAGTCATATGCTTGTCT 3’ / 5’ GCCTGCTGCCTTCCTT 3’ |
project name | Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment |
samp collect device | bottle |
samp mat process | filtering seawater |
samp size | 9L |
seq meth | Illumina sequencing by synthesis |
seq quality check | Average PHRED score >25 |
source mat id | Data pooled from nine DNA samples - AWFS-15-001; AWFS-15-002; AWFS-15-003; AWFS-15-004; AWFS-15-005; AWFS-15-006; AWFS-15-007; AWFS-15-008; AWFS-15-009 |
submitted to insdc | Dryad Digital Repository |
target gene | 18S rRNA |
target subfragment | V1-V3 |
Data quality tests
Test name | Result |
Coordinate uncertainty meters invalid | Warning |
Country inferred from coordinates | Warning |
Geodetic datum assumed WGS84 | Warning |
Show/Hide 72 passed properties | |
Show/Hide 7 missing properties | |
Show/Hide 32 tests that have not been run |
Additional political boundaries information
Area Management | |
CAPAD 2016 Marine | Ningaloo |
CAPAD 2020 Marine | Ningaloo |
NRM Regions 2010 | Rangelands |
NRM Regions 2017 | Rangelands Region |
Area management | |
National Landcare Program Management Units 2018 | Rangelands Region |
Biodiversity | |
IMCRA 4 Regions | Central Western Shelf Transition |
IMCRA Meso-scale Bioregions | Ningaloo |
Marine | |
States including coastal waters | Western Australia (including Coastal Waters) |
Political | |
Local Government Areas PSMA 2018 | SHIRE OF CARNARVON |
PSMA State Electoral Boundaries (2018) | MINING AND PASTORAL REGION |
Vegetation | |
Australia's Indigenous forest estate (2013) v2.0 | Indigenous owned, Non forest |
Forests of Australia (2013) v2.0 | Non Forest |
NVIS 4.1 Major Vegetation Groups | Cleared, non-native vegetation, buildings |
NVIS 4.1 Major Vegetation Subgroups | Cleared, non-native vegetation, buildings |
Tenure of Australia's forests (2013) v2.0 | Other Crown Land |