Occurrence record: Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment - EUK-1058

Material Sample of Pseudotontonia recorded on 2015-03-17
   API

Dataset

Data resource Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment
Catalog number EUK-1058
Record type Material Sample
Supplied basis "MaterialSample"
License CC-BY 4.0 (Int)
Associated references https://www.nature.com/articles/s41598-017-12501-5
Presence/Absence PRESENT
Supplied as present
Associated sequences https://datadryad.org/resource/doi:10.5061/dryad.qq11c

Event

Occurrence date 2015-03-17
Supplied date "17/03/2015"
Date precision DAY

Taxonomy

Scientific name Pseudotontonia
Identified to rank genus
Kingdom Protista
Supplied as "Chromista"
Phylum Ciliophora
Class Oligotrichea
Supplied as "Spirotrichea"
Order Oligotrichida
Family Tontoniidae
Supplied as "Totoniidae"
Genus Pseudotontonia
Name match metric exactMatch
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Locality Australia, West Australia, Coral Bay
Habitat
Supplied as "coral reef"
Latitude -23.154793
Supplied as: "-23.154793"
Longitude 113.766328
Supplied as: "113.766328"
Datum EPSG:4326
Coordinate precision Unknown
Terrestrial true
Biome TERRESTRIAL
Marine false
Country Code AU
Depth 0.5

Additional properties

alt elev sea level
biotic relationship environmental
chimera check Perseus
collection date 17/03/2015
data type comment You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/
env biome coral reef
env feature ocean
env material seawater
env package seawater
experimental factor environmental DNA survey
geo loc name Australia, West Australia, Coral Bay
investigation type survey, eukaryotes
lat lon -23.154793_113.766328
lib const meth Illumina paired-end sequencing
lib reads seqd 275067
nucl acid ext Qiagen Dneasy Blood & Tissue Kit
pcr cond initial denaturation at 95°C for 5 min, followed by 40 cycles of 30 s at 95°C, 30 s at 52, 58, or 64°C and 45 s at 72°C, with a final extension for 10 min at 72°C
pcr primers 5’ GCCAGTAGTCATATGCTTGTCT 3’ / 5’ GCCTGCTGCCTTCCTT 3’
project name Ecosystem biomonitoring with eDNA: metabarcoding across the tree of life in a tropical marine environment
samp collect device bottle
samp mat process filtering seawater
samp size 9L
seq meth Illumina sequencing by synthesis
seq quality check Average PHRED score >25
source mat id Data pooled from nine DNA samples - AWFS-15-001; AWFS-15-002; AWFS-15-003; AWFS-15-004; AWFS-15-005; AWFS-15-006; AWFS-15-007; AWFS-15-008; AWFS-15-009
Dryad Digital Repository
target gene 18S rRNA
target subfragment V1-V3

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate uncertainty meters invalid Warning
    Country inferred from coordinates Warning
    Geodetic datum assumed WGS84 Warning
    Show/Hide 72 passed properties
    Show/Hide 7 missing properties
    Show/Hide 32 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2016 Marine Ningaloo
    CAPAD 2020 Marine Ningaloo
    NRM Regions 2010 Rangelands
    NRM Regions 2017 Rangelands Region
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    IMCRA 4 Regions Central Western Shelf Transition
    IMCRA Meso-scale Bioregions Ningaloo
    Marine
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    Local Government Areas PSMA 2018 SHIRE OF CARNARVON
    PSMA State Electoral Boundaries (2018) MINING AND PASTORAL REGION
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Indigenous owned, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Other Crown Land

    Environmental sampling for this location

    Climate
    Precipitation - annual (Bio12) 233.2 mm
    Precipitation - coldest quarter (Bio19) 97.8 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 5.0 mm
    Precipitation - seasonality (Bio15) 84.0 mm
    Precipitation - warmest quarter (Bio18) 71.4 mm
    Precipitation - wettest period (Bio13) 12.0 mm
    Precipitation - wettest quarter (Bio16) 123.2 mm
    Radiation - annual mean (Bio20) 22.9 MJ/m2/day
    Radiation - seasonality (Bio23) 28.0
    Radiation - warmest quarter (Bio26) 27.6 MJ/m2/day
    Temperature - annual mean (Bio01) 24.46 degrees C
    Temperature - annual range (Bio07) 25.62 degrees C
    Temperature - coldest period min (Bio06) 11.82 degrees C
    Temperature - coldest quarter mean (Bio11) 18.82 degrees C
    Temperature - diurnal range mean (Bio02) 13.18 degrees C
    Temperature - driest quarter mean (Bio09) 24.84 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - seasonality (Bio04) 1.4760001
    Temperature - warmest period max (Bio05) 37.440002 degrees C
    Temperature - warmest quarter (Bio10) 29.94 degrees C
    Temperature - wettest quarter mean (Bio08) 19.98 degrees C
    Substrate
    Moisture Index - annual mean (Bio28) 0.11
    Moisture Index - highest quarter mean (Bio32) 0.3
    Elevation 0.0 m