Occurrence record: BOLD - Australian records - 3543027

Material Sample of LEPIDOPTERA | Butterflies recorded on 2009-04-13

API

Dataset

Data partner	Barcode of Life
Data resource	BOLD - Australian records
Catalog number	3543027
Other catalog numbers	["recordID:1417960;ProcessID:GWORY204-10;sampleID:BC EF Lep 03158"]
Record type	Material Sample Supplied basis "MaterialSample"
Collector	Friedrich, E. Supplied as "E. Friedrich"
Reproductive condition	sexual
Sex	male
Life stage	adult
License	CC-BY-Int
Presence/Absence	PRESENT
Identification ID	Egbert Friedrich

Event

Field Number	BC EF Lep 03158
Occurrence date	2009-04-13
Date precision	DAY

Taxonomy

Scientific name	LEPIDOPTERA
Identified to rank	order
Common name	Butterflies
Kingdom	Animalia
Phylum	Arthropoda
Class	Insecta
Order	Lepidoptera
Name match metric	exactMatch
Name parse type	SCIENTIFIC

Geospatial

Country	Australia
State or Territory	Queensland
Locality	Lake Euramoo
Latitude	-17.1411 Supplied as: "-17.1411"
Longitude	145.626 Supplied as: "145.626"
Datum	EPSG:4326
Coordinate precision	Unknown
Terrestrial	true
Biome	TERRESTRIAL
Marine	false
Country Code	AU

Additional properties

genbank accession	HM913384
markercode	COI-5P
nucleotides	TACATTATATTTTATTTTTGGAATTTGAGCTGGAATAGTCGGAACTTCTCTCAGATTATTAATTCGAGCTGAATTAGGTAATCCAGGTTCTCTAATTGGAGATGATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTCTTATATTAGGAGCTCCTGATATAGCTTTCCCCCGTATAAATAATATAAGTTTTTGATTACTTCCTCCTTCATTAACCTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCCCTTTCATCTAATATCGCACATAGAGGAAGATCAGTAGATTTAGCTATTTTCTCCCTCCACTTAGCTGGAATTTCCTCAATTCTAGGAGCTATTAATTTCATCACTACTATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGTATTACAGCATTTTTATTATTACTATCTCTTCCTGTTTTAGCTGGTGCTATTACTATATTACTTACTGATCGAAATCTCAATACATCCTTTTTTGACCCTGCGGGTGGAGGAGATCCTATTCTTTATCAACATTTATTT
Owner institution code	Research Collection of Egbert Friedrich
sequence last updated	2011-11-14T08:11:20Z

User flagged issues

Data quality tests

Test name	Result
Coordinate uncertainty meters invalid	Warning
Geodetic datum assumed WGS84	Warning
Name not supplied	Warning
Show/Hide 80 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate rounded	Passed
Coordinates dont match supplied country	Passed
Country inferred from coordinates	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
First of the year	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Modified date invalid	Passed
Modified date unlikely	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
Taxon match higher rank	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 7 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Missing taxon rank	Missing
Show/Hide 34 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
Footprint WKT mismatch	Unchecked (lack of data)
Footprint WKT invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
TAXON_MATCH_TAXON_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
TAXON_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Additional political boundaries information

Area Management
GER National Corridor	GER National Corridor
Great Eastern Ranges Initiative	GER Great Eastern Ranges Initiative
NRM Regions 2010	Wet Tropics
NRM Regions 2017	Wet Tropics
Area management
National Landcare Program Management Units 2018	Wet Tropics
Biodiversity
IBRA 6 Regions	Wet Tropics
IBRA 7 Regions	Wet Tropics
IBRA 7 Subregions	Bellenden Ker-Lamb
Hydrology
Drainage Divisions Level 1	North East Coast
Drainage Divisions Level 2	BARRON RIVER
Marine
States including coastal waters	Queensland (including Coastal Waters)
Political
ASGS Australian States and Territories	Queensland
Australian States and Territories	Queensland
Indigenous Land Use Agreements	Tableland Yidinji People and Tablelands Regional Council ILUA
Local Government Areas 2011	Tablelands (R)
Local Government Areas 2012 deprecated	Atherton
Local Government Areas PSMA 2018	TABLELANDS REGIONAL
National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes	Tableland Yidinji People
PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016)	15
PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016)	882
PSMA ABS Greater Capital City Statistical Areas (2016)	REST OF QLD
PSMA ABS SA2 Statistical Areas (2016)	MALANDA - YUNGABURRA
PSMA ABS SA3 Statistical Areas (2016)	TABLELANDS (EAST) - KURANDA
PSMA ABS SA4 Statistical Areas (2016)	CAIRNS
PSMA Commonwealth Electoral Boundaries (2018)	KENNEDY
PSMA Indigenous Areas (2016)	ATHERTON
PSMA Indigenous Locations (2016)	ATHERTON
PSMA Indigenous Regions (2016)	CAIRNS - ATHERTON
PSMA Remoteness Areas (2016)	Outer Regional Australia
PSMA State Electoral Boundaries (2018)	HILL
PSMA States (2016)	QUEENSLAND
World Country Boundaries	Australia
Vegetation
Australia's Indigenous forest estate (2013) v2.0	Other special rights, Industrial plantation
Forests of Australia (2013) v2.0	Softwood plantation
Forests of Australia 2018B	Non forest
NVIS 4.1 Major Vegetation Groups	Cleared, non-native vegetation, buildings
NVIS 4.1 Major Vegetation Subgroups	Cleared, non-native vegetation, buildings
Tenure of Australia's forests (2013) v2.0	Multiple Use Forest
Vegetation types - native	Rainforests and vine thickets
Vegetation types - present	cleared, non-native vegetation, buildings

Environmental sampling for this location

Climate
Precipitation - annual (Bio12)	1562.0 mm
Precipitation - coldest quarter (Bio19)	128.0 mm
Precipitation - driest period (Bio14)	5.0 mm
Precipitation - driest quarter (Bio17)	98.0 mm
Precipitation - seasonality (Bio15)	84.0 mm
Precipitation - warmest quarter (Bio18)	737.0 mm
Precipitation - wettest period (Bio13)	87.0 mm
Precipitation - wettest quarter (Bio16)	897.0 mm
Radiation - annual mean (Bio20)	19.0 MJ/m2/day
Radiation - seasonality (Bio23)	18.0
Radiation - warmest quarter (Bio26)	21.4 MJ/m2/day
Temperature - annual mean (Bio01)	21.2 degrees C
Temperature - annual range (Bio07)	17.3 degrees C
Temperature - coldest period min (Bio06)	12.3 degrees C
Temperature - coldest quarter mean (Bio11)	17.5 degrees C
Temperature - diurnal range mean (Bio02)	9.5 degrees C
Temperature - driest quarter mean (Bio09)	19.3 degrees C
Temperature - isothermality (Bio03)	0.55 %
Temperature - seasonality (Bio04)	0.91
Temperature - warmest period max (Bio05)	29.6 degrees C
Temperature - warmest quarter (Bio10)	24.2 degrees C
Temperature - wettest quarter mean (Bio08)	23.8 degrees C
WorldClim 2.1: Temperature - annual mean	20.441668 °C
WorldClim: Temperature - isothermality	56.0 %
Substrate
Moisture Index - annual mean (Bio28)	0.75
Moisture Index - highest quarter mean (Bio32)	1.0
Elevation	679.0 m

Group	Field Name	Original Value	Processed Value
Classification	Scientific name		LEPIDOPTERA
	Match type		exactMatch
	Phylum id		https://biodiversity.org.au/afd/taxa/ec21b060-78e8-4a37-9e62-b8bef532b001
	Taxon concept ID		https://biodiversity.org.au/afd/taxa/7cb6c81c-a7c4-4dd5-8578-fcfd2de847d6
	Order	Lepidoptera	Lepidoptera
	Taxon rank id		4000
	Left		295765
	Taxon rank		order
	Name type		SCIENTIFIC
	Vernacular name		Butterflies
	Order id		https://biodiversity.org.au/afd/taxa/7cb6c81c-a7c4-4dd5-8578-fcfd2de847d6
	Right		325027
	Kingdom		Animalia
	Class id		https://biodiversity.org.au/afd/taxa/17c9fd64-3c07-4df5-a33d-eda1e065e99f
	Phylum	Arthropoda	Arthropoda
	Class		Insecta
	Kingdom id		https://biodiversity.org.au/afd/taxa/4647863b-760d-4b59-aaa1-502c8cdf8d3c
Event	Year		2009
	Month		4
	Date precision		DAY
	Day		13
	Event date	2009-04-13	2009-04-13
Identification	Identification ID	Egbert Friedrich
Occurrence	Field number	BC EF Lep 03158
	Type		PhysicalObject
	Catalog number	3543027
	Occurrence status		PRESENT
	Basis of record	MaterialSample	MATERIAL_SAMPLE
	Modified	2011-11-14T08:11:20Z	2011-11-14T08:11:20Z
	Reproductive condition	sexual
	Sex	male	MALE
	Recorded by	E. Friedrich	[Friedrich, E.]
	Other catalog numbers	[recordID:1417960;ProcessID:GWORY204-10;sampleID:BC EF Lep 03158]
	Life stage	adult	{"concept": "Adult", "lineage": ["Adult"]}
Attribution	Data resource		BOLD - Australian records
	License		CC-BY-Int
	Data provider uid		dp35
	Provenance		Published dataset
	Data Resource ID	dr375	dr375
	Data partner		Barcode of Life
Location	Country	Australia	Australia
	Decimal latitude	-17.1411	-17.1411
	Terrestrial	true	true
	Locality	Lake Euramoo	Lake Euramoo
	Decimal longitude	145.626	145.626
	State province	Queensland	Queensland
	Biome		TERRESTRIAL
	Lga	Tablelands (R)
	Marine	false	false
	Country code		AU
	Geodetic datum		EPSG:4326