Occurrence record: BOLD - Australian records - 3774275

Material Sample of LEPIDOPTERA | Butterflies recorded on 1983-04-14
   API

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3774275
Other catalog numbers ["recordID:1655321;ProcessID:ANICM172-10;sampleID:10ANIC-09169"]
Record type Material Sample
Supplied basis "MaterialSample"
Collector 1.  Nielsen, E.S.   2.  Edwards, E.D.  
Supplied as "E.S.Nielsen, E.D.Edwards"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Presence/Absence PRESENT

Event

Occurrence date 1983-04-14
Date precision DAY

Taxonomy

Scientific name LEPIDOPTERA
Identified to rank order
Common name Butterflies
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Name match metric exactMatch
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Latitude -33.48
Supplied as: "-33.48"
Longitude 121.11
Supplied as: "121.11"
Datum EPSG:4326
Coordinate precision Unknown
Terrestrial true
Biome TERRESTRIAL
Marine false
Country Code AU

Additional properties

genbank accession HQ951854
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGTATTTGAGCAGGTTTAGTAGGAACATCATTAAGATTACTAATTCGAGCAGAATTAGGTAACCCTGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTCACAGCTCATGCTTTTATTATAATTTTTTTTATAGTGATACCTATTATAATTGGTGGATTTGGAAATTGATTAGTTCCATTAATACTAGGAGCCCCTGATATAGCTTTCCCCCGAATAAATAATATAAGATTTTGATTATTACCTCCATCTCTTACTCTTTTAATCTCAAGAAGAATTGTAGAAAACGGTGCTGGAACAGGTTGAACAGTTTACCCCCCGCTTTCATCTAACATTGCTCATGGAGGAAGATCTGTTGATTTAGCTATTTTTTCCTTACATTTAGCCGGAATTTCATCAATTTTAGGTGCAGTTAATTTTATTACAACTATTATTAATATACGACCAAATAATATATCTTTCGATCAAATACCTCTTTTCGTATGAGCTGTAGGAATTACTGCTTTATTATTACTTTTATCTTTACCTGTTCTAGCAGGAGCTATTACTATATTACTAACAGATCGGAATTTAAACACTTCATTTTTTGATCCCGCTGGAGGAGGTGATCCTATTCTTTATCAACACTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate uncertainty meters invalid Warning
    Geodetic datum assumed WGS84 Warning
    Name not supplied Warning
    Show/Hide 74 passed properties
    Show/Hide 7 missing properties
    Show/Hide 30 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2016 Terrestrial Cascade Nature Reserve
    CAPAD 2020 Terrestrial Cascade
    NRM Regions 2010 South Coast
    NRM Regions 2017 South Coast Region
    Area management
    National Landcare Program Management Units 2018 South Coast Region
    Biodiversity
    IBRA 6 Regions Mallee
    IBRA 7 Regions Mallee
    IBRA 7 Subregions Eastern Mallee
    Hydrology
    Drainage Divisions Level 1 South West Coast
    Drainage Divisions Level 2 ESPERANCE COAST
    Land Management
    Western Australian Biodiversity Science Research Priority Regions South-West
    Marine
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Local Government Areas 2011 Esperance (S)
    Local Government Areas 2012 deprecated Esperance
    Local Government Areas PSMA 2018 SHIRE OF ESPERANCE
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes The Esperance Nyungars
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 17
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 622
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) ESPERANCE REGION
    PSMA ABS SA3 Statistical Areas (2016) ESPERANCE
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - OUTBACK (SOUTH)
    PSMA Commonwealth Electoral Boundaries (2018) O'CONNOR
    PSMA Indigenous Areas (2016) ESPERANCE - RAVENSTHORPE
    PSMA Indigenous Locations (2016) ESPERANCE - RAVENSTHORPE - SURROUNDS
    PSMA Indigenous Regions (2016) KALGOORLIE
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA State Electoral Boundaries (2018) MINING AND PASTORAL REGION
    PSMA States (2016) WESTERN AUSTRALIA
    World Country Boundaries Australia
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Low Open
    Forests of Australia 2018B Eucalypt Low Open
    NVIS 4.1 Major Vegetation Groups Mallee Woodlands and Shrublands
    NVIS 4.1 Major Vegetation Subgroups Mallee with a dense shrubby understorey
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation types - native Eucalypt low open forests
    Vegetation types - present Eucalyptus low open forest

    Environmental sampling for this location

    Climate
    Precipitation - annual (Bio12) 403.0 mm
    Precipitation - coldest quarter (Bio19) 137.0 mm
    Precipitation - driest period (Bio14) 4.0 mm
    Precipitation - driest quarter (Bio17) 69.0 mm
    Precipitation - seasonality (Bio15) 29.0 mm
    Precipitation - warmest quarter (Bio18) 76.0 mm
    Precipitation - wettest period (Bio13) 13.0 mm
    Precipitation - wettest quarter (Bio16) 138.0 mm
    Radiation - annual mean (Bio20) 17.8 MJ/m2/day
    Radiation - seasonality (Bio23) 37.0
    Radiation - warmest quarter (Bio26) 24.3 MJ/m2/day
    Temperature - annual mean (Bio01) 16.7 degrees C
    Temperature - annual range (Bio07) 22.9 degrees C
    Temperature - coldest period min (Bio06) 6.3 degrees C
    Temperature - coldest quarter mean (Bio11) 12.0 degrees C
    Temperature - diurnal range mean (Bio02) 12.2 degrees C
    Temperature - driest quarter mean (Bio09) 20.2 degrees C
    Temperature - isothermality (Bio03) 0.53 %
    Temperature - seasonality (Bio04) 1.27
    Temperature - warmest period max (Bio05) 29.2 degrees C
    Temperature - warmest quarter (Bio10) 21.3 degrees C
    Temperature - wettest quarter mean (Bio08) 12.1 degrees C
    WorldClim 2.1: Temperature - annual mean 16.408333 °C
    WorldClim: Temperature - isothermality 54.0 %
    Substrate
    Moisture Index - annual mean (Bio28) 0.3
    Moisture Index - highest quarter mean (Bio32) 0.58
    Elevation 172.0 m