Occurrence record: BOLD - Australian records - 3560685

GenomicDNA of LEPIDOPTERA | Moths recorded on 2009-04-25

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3560685
Other catalog numbers recordID:1417206;ProcessID:GWORX450-10;sampleID:BC EF Lep 02216
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number BC EF Lep 02216
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Lep 02216
Record date 2009-04-25
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland
Locality Cairns (R)
Locality Alexandra Lookout
Latitude -16.2458
Longitude 145.436
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM912686
markercode COI-5P
nucleotides GACATTATATTTTATTTTTGGAATTTGAGCGGGAATAATTGGAACTTCTTTAAGTTTATTAATTCGAGCTGAACTAGGAAATCCAGGATCTTTAATTGGTGATGACCAAATTTATAACACTATTGTTACAGCCCATGCTTTCATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCTGATATAGCATTCCCACGAATAAATAATATAAGATTTTGATTGCTTCCTCCTTCTATTACTTTATTAATCTCTAGAAGAATTGTAGAAAATGGAGCTGGGACTGGTTGAACAGTTTACCCACCTTTATCTTCTAATATTGCTCATGGAGGTAGATCAGTAGATTTAGCTATTTTTTCTTTACATTTAGCAGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTACAACAATTATTAATATACGATTAAATAATATATCATTTGATCAAATACCTTTATTTGTCTGAGCTGTAGGTATTACAGCATTCTTATTATTATTATCTTTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGACCCTGCTGGAGGAGGAGACCCAATTCTTTACCAACATTTATTT
Owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:19Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    CAPAD 2010 Terrestrial Daintree
    CAPAD 2012 Terrestrial Daintree
    CAPAD 2014 Terrestrial Daintree
    CAPAD 2016 Terrestrial Eastern Kuku Yalanji
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Great Barrier Reef
    Global 200 priority ecoregions - Terrestrial Queensland Tropical Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 Wet Tropics
    NRM Regions 2014 Wet Tropics
    NRM Regions 2015 Wet Tropics
    NRM Regions 2017 Wet Tropics
    NRM Regions 2017 (Qld 2019) Wet Tropics
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Wet Tropics
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Wet Tropics
    IBRA 6 Sub Regions Daintree - Bloomfield
    IBRA 7 Regions Wet Tropics
    IBRA 7 Subregions Daintree-Bloomfield
    Terrestrial Ecoregional Boundaries Queensland Tropical Rain Forests
    World Anthropogenic Biomes (2000) Populated woodlands
    Climate
    Agroclimatic classification of Australia Moisture and temperature regime supports growth for 8���9 months of the year, with a 3���4 month dry season
    Koppen Climate Classification (All Classes) Tropical: rainforest (persistently wet)
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Rainforest (tropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 DAINTREE RIVER
    River Regions DAINTREE RIVER
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Leichhardt
    Indigenous Land Use Agreements Eastern Kuku Yalanji & Ergon
    Local Government Areas 2011 Cairns (R)
    Local Government Areas 2012 deprecated Douglas
    Local Government Areas PSMA 2018 DOUGLAS SHIRE
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 192
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 282
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) DAINTREE
    PSMA ABS SA3 Statistical Areas (2016) PORT DOUGLAS - DAINTREE
    PSMA ABS SA4 Statistical Areas (2016) CAIRNS
    PSMA Commonwealth Electoral Boundaries (2016) LEICHHARDT
    PSMA Commonwealth Electoral Boundaries (2018) LEICHHARDT
    PSMA Indigenous Areas (2016) WUJAL WUJAL AND OUTSTATIONS
    PSMA Indigenous Locations (2016) CAPE TRIBULATION - CHINA CAMP - ZIG ZAG
    PSMA Indigenous Regions (2016) CAIRNS - ATHERTON
    PSMA Localities (2018) KIMBERLEY
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) COOK
    PSMA State Electoral Boundaries (2018) COOK
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Cairns (R) - Douglas
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Cairns Region
    Surface Geology of Australia Dshm
    Topography
    Physiographic Provinces of Australia Peninsular Uplands Province
    Physiographic Regions 2011 Cairns Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Rainforest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    NVIS 4.1 Major Vegetation Subgroups Tropical or sub-tropical rainforest
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Rainforests and vine thickets
    Vegetation types - present Rainforest and vine thickets

    Environmental sampling for this location

    Area Management
    Beef numbers 48075.0 dse
    Dairy numbers 0.0 dse
    Natural resource management expenditure 4148781.0 $
    Natural resource management expenditure - additional 2.0 $/ha
    Sheep numbers 65.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5241
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.7849
    Endemism 0.041210324
    Endemism (Non-marine) 0.048791084
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 15.0 frequency
    Occurrence Density 12598.0 frequency
    Shannon Diversity (H) 6.4215155 index
    Species Richness 2122.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 14.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 1.4029258
    2030A1BMk35M: Aridity index - month max 3.8578026
    2030A1BMk35M: Aridity index - month min 0.19391283
    2030A1BMk35M: Evaporation - annual mean 172.72583 mm
    2030A1BMk35M: Evaporation - month max 216.85 mm
    2030A1BMk35M: Evaporation - month min 133.09 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.63 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.43 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.55 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 75.721115 %
    2030A1BMk35M: Humidity - month max relative 3pm 79.52659 %
    2030A1BMk35M: Humidity - month min relative 3pm 70.30385 %
    2030A1BMk35M: Precipitation - annual mean 236.49583 mm
    2030A1BMk35M: Precipitation - driest month 42.05 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.22544594
    2030A1BMk35M: Precipitation - max difference between successive months 7.973871 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -6.906763 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 6.6882753
    2030A1BMk35M: Precipitation - spring or autumn season -3.4212923
    2030A1BMk35M: Precipitation - summer or winter season 5.6600723
    2030A1BMk35M: Precipitation - wettest month 609.88 mm
    2030A1BMk35M: Precipitation deficit - annual mean 63.770004 mm
    2030A1BMk35M: Precipitation deficit - month max -174.8 mm
    2030A1BMk35M: Precipitation deficit - month min 451.79 mm
    2030A1BMk35M: Radiation - max month precipitation modified 24.31 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 18.344166 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 13.57 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 29.0275 degrees C
    2030A1BMk35M: Temperature - annual min mean 21.6275 degrees C
    2030A1BMk35M: Temperature - annual range 13.869995 degrees C
    2030A1BMk35M: Temperature - coldest month min 18.04 degrees C
    2030A1BMk35M: Temperature - coolest month max 25.29 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.9599915 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.9100037 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 8.359985 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 7.399999 degrees C
    2030A1BMk35M: Temperature - min difference in max -1.6099854 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.9300232 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 6.380005 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 31.91 degrees C
    2030A1BMk35M: Temperature - warmest month min 24.38 degrees C
    Aridity index - annual mean 1.6557412
    Aridity index - month max 4.270541
    Aridity index - month min 0.32645726
    Evaporation - annual mean 163.70587 (ml/5km x 5km pixel)
    Evaporation - average 41516.0 ml
    Evaporation - month max 217.21 mm
    Evaporation - month min 116.82371 mm
    Evaporation - variability 4.0 %
    Growth index C3 macrotherm plants - annual mean 0.61 index
    Growth index C3 mesotherm plants - annual mean 0.61 index
    Growth index C4 megatherm plants - annual mean 0.49 index
    Humidity - annual mean relative 81.944954 %
    Humidity - annual mean relative 3pm 74.82111 %
    Humidity - month max relative 86.350334 %
    Humidity - month max relative 3pm 78.73908 %
    Humidity - month min relative 69.6725 %
    Humidity - month min relative 3pm 69.6725 %
    Precipitation - annual 3092.0 mm
    Precipitation - annual (Bio12) 3009.0 mm
    Precipitation - annual (log) seasonality index 0.13456485
    Precipitation - annual mean 255.82887 mm
    Precipitation - annual seasonality 1.4902024
    Precipitation - annual seasonality ratio 2.4918976
    Precipitation - autumn 1303.0 mm
    Precipitation - autumn reliability 46.0 %
    Precipitation - coldest quarter (Bio19) 222.0 mm
    Precipitation - driest month 67.045135 mm
    Precipitation - driest period (Bio14) 11.0 mm
    Precipitation - driest quarter (Bio17) 183.0 mm
    Precipitation - equinox seasonality ratio 0.23175824
    Precipitation - max difference between successive months 9.648897 mm/day
    Precipitation - min difference between successive months -8.814955 mm/day
    Precipitation - seasonality (Bio15) 81.0 mm
    Precipitation - solstice seasonality ratio 4.8402014
    Precipitation - spring 281.0 mm
    Precipitation - spring or autumn (log) season -0.25971717
    Precipitation - spring or autumn season -3.3028102
    Precipitation - spring reliability 33.0 %
    Precipitation - summer 1460.0 mm
    Precipitation - summer or winter (log) season 0.27991757
    Precipitation - summer or winter season 3.8263292
    Precipitation - summer reliability 48.0 %
    Precipitation - warmest quarter (Bio18) 1300.0 mm
    Precipitation - wettest month 648.24585 mm
    Precipitation - wettest period (Bio13) 148.0 mm
    Precipitation - wettest quarter (Bio16) 1663.0 mm
    Precipitation - winter 285.0 mm
    Precipitation - winter reliability 34.0 %
    Precipitation deficit - annual mean 92.12301 mm
    Precipitation deficit - month max -145.98293 mm
    Precipitation deficit - month min 496.45105 mm
    Radiation - annual mean (Bio20) 18.2 MJ/m2/day
    Radiation - coldest quarter (Bio27) 15.7 MJ/m2/day
    Radiation - driest quarter (Bio25) 17.9 MJ/m2/day
    Radiation - highest period (Bio21) 24.6 MJ/m2/day
    Radiation - lowest period (Bio22) 12.9 MJ/m2/day
    Radiation - max month precipitation modified 24.303093 MJ/m2/day
    Radiation - mean annual precipitation modified 18.12743 MJ/m2/day
    Radiation - min month precipitation modified 13.503095 MJ/m2/day
    Radiation - seasonality (Bio23) 17.0
    Radiation - warmest quarter (Bio26) 20.4 MJ/m2/day
    Radiation - wettest quarter (Bio24) 18.2 MJ/m2/day
    Temperature - annual max mean 27.025 degrees C
    Temperature - annual mean (Bio01) 24.5 degrees C
    Temperature - annual min mean 19.721666 degrees C
    Temperature - annual range 13.9711 degrees C
    Temperature - annual range (Bio07) 13.9 degrees C
    Temperature - coldest month min 16.12 degrees C
    Temperature - coldest period min (Bio06) 17.2 degrees C
    Temperature - coldest quarter mean (Bio11) 21.4 degrees C
    Temperature - coolest month max 23.25 degrees C
    Temperature - diurnal range mean (Bio02) 7.3 degrees C
    Temperature - driest quarter mean (Bio09) 22.5 degrees C
    Temperature - isothermality (Bio03) 0.53 %
    Temperature - max absolute mean max 38.0 degrees C
    Temperature - max difference in max 1.8299866 degrees C/day
    Temperature - max difference in min 1.9899902 degrees C/day
    Temperature - max month diurnal range 8.029999 degrees C
    Temperature - mean annual absolute mean min 12.481426 degrees C
    Temperature - mean annual diurnal range 7.3033347 degrees C
    Temperature - min absolute mean min 6.0028744 degrees C
    Temperature - min difference in max -1.7900085 degrees C/day
    Temperature - min difference in min -1.9299927 degrees C/day
    Temperature - min month diurnal range 6.700012 degrees C
    Temperature - month hottest maximum 29.91 degrees C
    Temperature - month mean absolute max 34.59371 degrees C
    Temperature - seasonality (Bio04) 0.76
    Temperature - warmest month min 22.65 degrees C
    Temperature - warmest period max (Bio05) 31.1 degrees C
    Temperature - warmest quarter (Bio10) 27.1 degrees C
    Temperature - wettest quarter mean (Bio08) 26.6 degrees C
    Vapour pressure deficit - annual mean 0.35709023 KPa
    Vapour pressure deficit - annual mean 9am 0.4210345 KPa
    Vapour pressure deficit - month max 0.6065831 KPa
    Vapour pressure deficit - month max 9am 0.6065831 KPa
    Vapour pressure deficit - month min 0.18346143 KPa
    Vapour pressure deficit - month min 9am 0.2589488 KPa
    Wind run - annual mean 195.75171 km/day
    Wind run - month max 226.28299 km/day
    Wind run - month min 151.61575 km/day
    Wind speed - annual mean 3pm 4.6302495 m/s
    Wind speed - annual mean 9am 2.8990817 m/s
    Wind speed - annual mean 9am or 3pm 4.509449 m/s
    Wind speed - month max 3pm 5.4 m/s
    Wind speed - month max 9am 3.6188982 m/s
    Wind speed - month max 9am or 3pm 5.4 m/s
    Wind speed - month min 3pm 3.7062995 m/s
    Wind speed - month min 9am 2.0062995 m/s
    Wind speed - month min 9am or 3pm 2.0062995 m/s
    WorldClim: Precipitation - annual 2089.0 mm
    WorldClim: Precipitation - coldest quarter 118.0 mm
    WorldClim: Precipitation - driest month 29.0 mm
    WorldClim: Precipitation - driest quarter 101.0 mm
    WorldClim: Precipitation - seasonality 90.0
    WorldClim: Precipitation - warmest quarter 1035.0 mm
    WorldClim: Precipitation - wettest month 439.0 mm
    WorldClim: Precipitation - wettest quarter 1279.0 mm
    WorldClim: Temperature - annual mean 245.0 degrees C * 10
    WorldClim: Temperature - annual range 145.0 degrees C * 10
    WorldClim: Temperature - coldest month min 169.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 214.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 86.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 220.0 degrees C * 10
    WorldClim: Temperature - isothermality 59.0 %
    WorldClim: Temperature - seasonality 2138.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 314.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 269.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 266.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.031622775 degrees
    Distance - to coast 0.04123105 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.031622775 km
    Euclidean Distance to Coast (metres) 2278.3691 m
    Remoteness index 6.422576
    Hydrology
    Drainage - average 3552.0 megalitres/5x5km/year
    Drainage - variability 36.0 %
    Runoff - average 41024.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 213.71 m
    Social
    Age 37.9 years
    Age - prime group 31.9 Count
    Disadvantaged 1036.05 points (mean=1000)
    Education - degrees 9.9 %
    Education - vocational training 29.3 %
    Employment 5.2 %
    Home ownership 45.8 %
    Income - high 29.0 %
    Income - low 14.1 %
    Internet 47.3 %
    Population - change 3.1 count
    Population - density SLA 2006 p/sqkm) 4.2 people/km^2
    Unemployment rate 1.7 %
    Work force - older 28.3 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.77511346
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.19391283
    2030A1BMk35M: Water deficit - month max 62.426136 mm
    2030A1BMk35M: Water deficit - month mean 12.961487 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.54177594 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 69.76021
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 17.452154
    2030A1BMk35M: Water surplus - annual mean 106.57008 mm
    2030A1BMk35M: Water surplus - month max 467.599 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 12.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.7 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 7.0 %
    Bouguer gravity anomalies 315.7853 Gal
    Bulk density 1.1943437 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic -85.344635 %
    Carbon store pre-European 377.9887 kgC/ha
    Clay % 44.675674 %
    Crop factor - annual mean 0.8256291
    Crop factor - month max 0.9
    Crop factor - month min 0.32645726
    Erodibility 17.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 24734.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 130.76923 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 56.8 my
    Lithology - fertility 6.0 index
    Lithology - mean age 387.6 my
    Lithology - mean age (log) 2.5883837 log my
    Lithology - mean age range (log) 1.7543483 log my
    Magnetic anomalies -139.0 nT
    Moisture - average 66.0 %
    Moisture - variability 6.0 %
    Moisture Index - annual mean (Bio28) 0.82
    Moisture Index - coldest quarter mean (Bio35) 0.88
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.27
    Moisture Index - lowest quarter mean (Bio33) 0.42
    Moisture Index - seasonality (Bio31) 31.0
    Moisture Index - warmest quarter mean (Bio34) 0.95
    Nitrogen - plant-available pre-European 33089.61 kgN/ha
    Nitrogen concentration pre-European 57.38757 mgN kg/H2O
    Nitrogen store pre-European 391.5643 kgN/ha
    Nutrient status 2.1 index
    Pedality hydrological score 4.116216
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 71.87079 kgP/ha
    Phosphorus - plant-available total pre-European 4077.4902 kgP/ha
    Phosphorus pre-European 10.53337 mgP kg/H2O
    Soil depth 1.3 m
    Soil pedality 4.116216
    Soils - coarse 0.0 class
    Substrate data reliability 3.0
    Topographic wetness index 1.958744
    Unreliable water retention parameters 8.461538
    Water deficit - month max 71.71304 mm
    Water deficit - month mean 10.075404 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 38250.0 mm
    Water holding capacity - plant-available 201.0 mm
    Water potential - annual mean -0.4556479 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 74.30662
    Water stress index - month max 81.0
    Water stress index - month min 29.381153
    Water surplus - annual mean 124.493065 mm
    Water surplus - month max 511.63055 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 0.24179 Weathering Intensity Index
    Topography
    Aspect 354.0 degrees
    Averaged Topographic Relief 425.04166 metres
    Bathymetry and Topography 9 sec 205.0 m
    Elevation 85.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 3.9102125 degrees
    Topographic relief 164.4786 m
    Topographic roughness 21.3936 %
    Topographic slope (%) 10.06867 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2605 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 21.0 %
    Gross Primary Productivity (2012-03-13) 0.0028 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.5 m^2 plant / m^2 ground
    NDVI Mean 86.0 NDVI x 100
    NPP Mean 13.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.4549 NDVI