Occurrence record: BOLD - Australian records - 2847386

GenomicDNA of Imber tropicus recorded on 2004-02-08

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 2847386
Other catalog numbers recordID:318011;ProcessID:SOWA197-06;sampleID:BC-Hax0197
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Reproductive condition sexual
Sex female
Life stage adult
Associated Occurrence Status Representative record
Associated occurrences This record has 2 inferred associated occurrences
For more information see Inferred associated occurrence details
License CC-BY-Int
Field number BC-Hax0197
Occurrence remarks
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Jean J. Haxaire

Event

Field number BC-Hax0197
Record date 2004-02-08
Date precision Day

Taxonomy

Scientific name Imber tropicus
Taxon rank species
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Family Sphingidae
Genus Imber
Species Imber tropicus
Taxonomic issue No issues
Name match metric Canonical name match
The supplied name was parsed into canonical form before a match was found.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland
Locality Etheridge (S)
Locality 30 km. East of Georgetown
Latitude -18.293
Longitude 143.833
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession JN678074
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTGGGAACTTCTTTAAGATTATTAATTCGAGCTGAATTAGGAAATCCCGGATCTCTAATTGGAGATGATCAAATTTATAATACAATTGTTACAGCTCATGCATTTATTATAATTTTCTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGTGCACCCGATATAGCTTTCCCACGAATAAATAACATAAGATTTTGACTACTCCCCCCATCCTTAACCCTGCTTATTTCTAGAAGTATTGTAGAAAATGGAGCTGGTACAGGATGAACAGTTTACCCCCCTTTATCATCAAATATTGCTCATAGTGGAAGATCTGTTGATTTAGCTATCTTCTCTTTACATTTAGCTGGTATTTCCTCTATTTTAGGAGCTATTAACTTTATTACAACAATTATTAATATGCGAATTAATAATATATCTTTTGATCAAATACCATTATTTGTTTGAGCAGTTGGAATTACAGCTTTTTTATTATTATTATCTTTACCCGTTTTAGCTGGAGCTATTACAATACTTTTAACTGATCGAAATTTAAATACATCTTTTTTTGACCCTGCTGGTGGGGGGGATCCTATTCTATACCAACATTTATTT
Owner institution code Research Collection of Jean Haxaire
sequence last updated 2011-11-14T08:11:10Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Habitat incorrect for species Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Inferred associated occurrence details

    This record has been identified as the representative occurrence in a group of associated occurrences. This mean other records have been detected that seem to relate to this record and this particular record has the most detailed information on the occurrence. More information about the duplication detection methods and terminology in use is available here:

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) No practices
    Fallow practice - dominant (number) No practices
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Irrigation practice - dominant No irrigation
    Land use Grazing of native pastures
    NRM Regions 2010 Northern Gulf
    NRM Regions 2014 Northern Gulf
    NRM Regions 2015 Northern Gulf
    NRM Regions 2017 Northern Gulf
    NRM Regions 2017 (Qld 2019) Northern Gulf
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Northern Gulf
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Einasleigh Uplands
    IBRA 6 Sub Regions Kidston
    IBRA 7 Regions Einasleigh Uplands
    IBRA 7 Subregions Kidston
    Terrestrial Ecoregional Boundaries Einasleigh Upland Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with cooler winter and with a growing season lasting at least six months
    Koppen Climate Classification (All Classes) Tropical: savanna
    Koppen Climate Classification (Major Classes) Tropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    National Indicative Aggregated Fire Extent Dataset 2019-2020 - v20200324 National Indicative Aggregated Fire Extent 2019-2020
    Hydrology
    Drainage Divisions Level 1 Carpentaria Coast
    Drainage Divisions Level 2 FLINDERS-NORMAN RIVERS
    River Regions FLINDERS-NORMAN RIVERS
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Kennedy
    Indigenous Land Use Agreements Ewamian People Exploration Permit Backlog Project
    Local Government Areas 2011 Etheridge (S)
    Local Government Areas 2012 deprecated Etheridge
    Local Government Areas PSMA 2018 ETHERIDGE SHIRE
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Ewamian People #3
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 57
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1654
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) CROYDON - ETHERIDGE
    PSMA ABS SA3 Statistical Areas (2016) FAR NORTH
    PSMA ABS SA4 Statistical Areas (2016) QUEENSLAND - OUTBACK
    PSMA Commonwealth Electoral Boundaries (2016) KENNEDY
    PSMA Commonwealth Electoral Boundaries (2018) KENNEDY
    PSMA Indigenous Areas (2016) KURANDA - CROYDON
    PSMA Indigenous Locations (2016) ETHERIDGE TABLELANDS
    PSMA Indigenous Regions (2016) CAIRNS - ATHERTON
    PSMA Localities (2018) EINASLEIGH
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) MOUNT ISA
    PSMA State Electoral Boundaries (2018) TRAEGER
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Etheridge (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Georgetown Region
    Surface Geology of Australia Sgwh
    Topography
    Physiographic Provinces of Australia Peninsular Uplands Province
    Physiographic Regions 2011 Newcastle Ranges
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Low Open
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus open forests with a grassy understorey
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Transformed
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Beef numbers 3566318.0 dse
    Dairy numbers 0.0 dse
    Gypsum 0.0 t/ha
    Lime 1.0 t/ha
    Natural resource management expenditure 3003802.0 $
    Natural resource management expenditure - additional 0.0 $/ha
    Nitrogen 0.126227 t/ha
    Sheep numbers 0.0 dse
    Area management
    Phosphorus 0.017197 t/ha
    Potassium 0.100039 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5098
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.0892
    Endemism 0.009432007
    Endemism (Non-marine) 0.009480542
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 5.0 frequency
    Occurrence Density 320.0 frequency
    Shannon Diversity (H) 4.6974497 index
    Species Richness 135.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 3.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.30433044
    2030A1BMk35M: Aridity index - month max 1.2397351
    2030A1BMk35M: Aridity index - month min 0.009131262
    2030A1BMk35M: Evaporation - annual mean 184.72667 mm
    2030A1BMk35M: Evaporation - month max 255.82 mm
    2030A1BMk35M: Evaporation - month min 112.29 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.28 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.1 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.26 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 52.750443 %
    2030A1BMk35M: Humidity - month max relative 3pm 63.557457 %
    2030A1BMk35M: Humidity - month min relative 3pm 42.402798 %
    2030A1BMk35M: Precipitation - annual mean 59.88 mm
    2030A1BMk35M: Precipitation - driest month 1.44 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.5700384
    2030A1BMk35M: Precipitation - max difference between successive months 3.5832262 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -5.1621437 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 54.040565
    2030A1BMk35M: Precipitation - spring or autumn season -0.7426368
    2030A1BMk35M: Precipitation - summer or winter season 48.156536
    2030A1BMk35M: Precipitation - wettest month 215.28 mm
    2030A1BMk35M: Precipitation deficit - annual mean -124.846664 mm
    2030A1BMk35M: Precipitation deficit - month max -243.89001 mm
    2030A1BMk35M: Precipitation deficit - month min 41.630005 mm
    2030A1BMk35M: Radiation - max month precipitation modified 26.55 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 20.695833 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 15.5 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 32.77833 degrees C
    2030A1BMk35M: Temperature - annual min mean 18.288334 degrees C
    2030A1BMk35M: Temperature - annual range 25.269989 degrees C
    2030A1BMk35M: Temperature - coldest month min 11.7 degrees C
    2030A1BMk35M: Temperature - coolest month max 27.87 degrees C
    2030A1BMk35M: Temperature - max difference in max 3.2600098 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 3.8000183 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 17.330017 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 14.489995 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.149994 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -3.649994 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 11.309998 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 36.97 degrees C
    2030A1BMk35M: Temperature - warmest month min 22.94 degrees C
    Aridity index - annual mean 0.378503
    Aridity index - month max 1.4422548
    Aridity index - month min 0.025224268
    Evaporation - annual mean 174.32538 (ml/5km x 5km pixel)
    Evaporation - average 15321.0 ml
    Evaporation - month max 250.25076 mm
    Evaporation - month min 115.69871 mm
    Evaporation - variability 20.0 %
    Growth index C3 macrotherm plants - annual mean 0.33 index
    Growth index C3 mesotherm plants - annual mean 0.24 index
    Growth index C4 megatherm plants - annual mean 0.29 index
    Humidity - annual mean relative 69.18331 %
    Humidity - annual mean relative 3pm 52.084778 %
    Humidity - month max relative 79.00054 %
    Humidity - month max relative 3pm 62.735806 %
    Humidity - month min relative 41.837807 %
    Humidity - month min relative 3pm 41.837807 %
    Precipitation - annual 804.0 mm
    Precipitation - annual (Bio12) 773.0 mm
    Precipitation - annual (log) seasonality index 0.5971551
    Precipitation - annual mean 65.75 mm
    Precipitation - annual seasonality 10.758064
    Precipitation - annual seasonality ratio 11.934426
    Precipitation - autumn 158.0 mm
    Precipitation - autumn reliability 20.0 %
    Precipitation - coldest quarter (Bio19) 21.0 mm
    Precipitation - driest month 4.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 15.0 mm
    Precipitation - equinox seasonality ratio 0.48447204
    Precipitation - max difference between successive months 3.3548386 mm/day
    Precipitation - min difference between successive months -3.3722525 mm/day
    Precipitation - seasonality (Bio15) 122.0 mm
    Precipitation - solstice seasonality ratio 25.190475
    Precipitation - spring 76.0 mm
    Precipitation - spring or autumn (log) season -0.1643568
    Precipitation - spring or autumn season -1.050633
    Precipitation - spring reliability 20.0 %
    Precipitation - summer 525.0 mm
    Precipitation - summer or winter (log) season 1.0293727
    Precipitation - summer or winter season 23.09091
    Precipitation - summer reliability 48.0 %
    Precipitation - warmest quarter (Bio18) 369.0 mm
    Precipitation - wettest month 211.0 mm
    Precipitation - wettest period (Bio13) 58.0 mm
    Precipitation - wettest quarter (Bio16) 557.0 mm
    Precipitation - winter 19.0 mm
    Precipitation - winter reliability 6.0 %
    Precipitation deficit - annual mean -108.57538 mm
    Precipitation deficit - month max -233.25076 mm
    Precipitation deficit - month min 64.701294 mm
    Radiation - annual mean (Bio20) 20.6 MJ/m2/day
    Radiation - coldest quarter (Bio27) 16.7 MJ/m2/day
    Radiation - driest quarter (Bio25) 19.7 MJ/m2/day
    Radiation - highest period (Bio21) 26.5 MJ/m2/day
    Radiation - lowest period (Bio22) 15.2 MJ/m2/day
    Radiation - max month precipitation modified 26.4 MJ/m2/day
    Radiation - mean annual precipitation modified 20.497776 MJ/m2/day
    Radiation - min month precipitation modified 15.4 MJ/m2/day
    Radiation - seasonality (Bio23) 17.0
    Radiation - warmest quarter (Bio26) 24.3 MJ/m2/day
    Radiation - wettest quarter (Bio24) 21.5 MJ/m2/day
    Temperature - annual max mean 30.64 degrees C
    Temperature - annual mean (Bio01) 24.5 degrees C
    Temperature - annual min mean 16.415 degrees C
    Temperature - annual range 25.973328 degrees C
    Temperature - annual range (Bio07) 25.3 degrees C
    Temperature - coldest month min 10.14 degrees C
    Temperature - coldest period min (Bio06) 10.6 degrees C
    Temperature - coldest quarter mean (Bio11) 19.4 degrees C
    Temperature - coolest month max 25.9 degrees C
    Temperature - diurnal range mean (Bio02) 14.4 degrees C
    Temperature - driest quarter mean (Bio09) 21.5 degrees C
    Temperature - isothermality (Bio03) 0.57 %
    Temperature - max absolute mean max 43.0 degrees C
    Temperature - max difference in max 2.9599915 degrees C/day
    Temperature - max difference in min 3.4599915 degrees C/day
    Temperature - max month diurnal range 16.809998 degrees C
    Temperature - mean annual absolute mean min 3.6640954 degrees C
    Temperature - mean annual diurnal range 14.224996 degrees C
    Temperature - min absolute mean min -2.206752 degrees C
    Temperature - min difference in max -2.1700134 degrees C/day
    Temperature - min difference in min -3.1600037 degrees C/day
    Temperature - min month diurnal range 10.959991 degrees C
    Temperature - month hottest maximum 34.79 degrees C
    Temperature - month mean absolute max 38.881695 degrees C
    Temperature - seasonality (Bio04) 1.19
    Temperature - warmest month min 20.95 degrees C
    Temperature - warmest period max (Bio05) 36.0 degrees C
    Temperature - warmest quarter (Bio10) 28.3 degrees C
    Temperature - wettest quarter mean (Bio08) 27.8 degrees C
    Vapour pressure deficit - annual mean 1.0059569 KPa
    Vapour pressure deficit - annual mean 9am 1.1240486 KPa
    Vapour pressure deficit - month max 1.6785519 KPa
    Vapour pressure deficit - month max 9am 1.6785519 KPa
    Vapour pressure deficit - month min 0.5214908 KPa
    Vapour pressure deficit - month min 9am 0.73444796 KPa
    Wind run - annual mean 116.268906 km/day
    Wind run - month max 136.2 km/day
    Wind run - month min 95.5024 km/day
    Wind speed - annual mean 3pm 2.425 m/s
    Wind speed - annual mean 9am 2.5833333 m/s
    Wind speed - annual mean 9am or 3pm 3.0 m/s
    Wind speed - month max 3pm 2.8 m/s
    Wind speed - month max 9am 3.2 m/s
    Wind speed - month max 9am or 3pm 3.2 m/s
    Wind speed - month min 3pm 2.0 m/s
    Wind speed - month min 9am 2.0 m/s
    Wind speed - month min 9am or 3pm 2.0 m/s
    WorldClim: Precipitation - annual 840.0 mm
    WorldClim: Precipitation - coldest quarter 15.0 mm
    WorldClim: Precipitation - driest month 3.0 mm
    WorldClim: Precipitation - driest quarter 13.0 mm
    WorldClim: Precipitation - seasonality 117.0
    WorldClim: Precipitation - warmest quarter 416.0 mm
    WorldClim: Precipitation - wettest month 241.0 mm
    WorldClim: Precipitation - wettest quarter 584.0 mm
    WorldClim: Temperature - annual mean 240.0 degrees C * 10
    WorldClim: Temperature - annual range 255.0 degrees C * 10
    WorldClim: Temperature - coldest month min 102.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 189.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 149.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 203.0 degrees C * 10
    WorldClim: Temperature - isothermality 58.0 %
    WorldClim: Temperature - seasonality 3483.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 357.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 278.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 267.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 2.173315 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.117047 km
    Euclidean Distance to Coast (metres) 216970.86 m
    Remoteness index 15.052701
    Fire
    Fire - time since last 5.0 years
    Fire frequency 2.0 frequency
    Hydrology
    Drainage - average 633.0 megalitres/5x5km/year
    Drainage - variability 92.0 %
    Runoff - average 2020.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 463.4 m
    Social
    Age 39.1 years
    Age - prime group 29.5 Count
    Disadvantaged 979.16 points (mean=1000)
    Education - degrees 5.1 %
    Education - vocational training 21.1 %
    Employment 51.5 %
    Home ownership 58.1 %
    Income - high 17.9 %
    Income - low 23.4 %
    Internet 35.5 %
    Population - change -8.5 count
    Population - density SLA 2006 p/sqkm) 0.0 people/km^2
    Unemployment rate 1.4 %
    Work force - older 28.0 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.30284
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.009131262
    2030A1BMk35M: Water deficit - month max 115.03903 mm
    2030A1BMk35M: Water deficit - month mean 31.4375 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.3288665 MPa
    2030A1BMk35M: Water potential - month max -0.14187194 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 27.255598
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 0.8218136
    2030A1BMk35M: Water surplus - annual mean 0.0 mm
    2030A1BMk35M: Water surplus - month max 0.0 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 46.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.37 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 48.0 %
    Bouguer gravity anomalies -264.3654 Gal
    Bulk density 1.482602 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.1535229 %
    Carbon store pre-European 15.32744 kgC/ha
    Clay % 5.1415815 %
    Crop factor - annual mean 0.380734
    Crop factor - month max 0.90000004
    Crop factor - month min 0.025224268
    Erodibility 14.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 5556.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 100.0 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 27.7 my
    Lithology - fertility 6.0 index
    Lithology - mean age 424.65 my
    Lithology - mean age (log) 2.628031 log my
    Lithology - mean age range (log) 1.4424797 log my
    Magnetic anomalies 94.0 nT
    Moisture - average 34.0 %
    Moisture - variability 15.0 %
    Moisture Index - annual mean (Bio28) 0.37
    Moisture Index - coldest quarter mean (Bio35) 0.06
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 0.94
    Moisture Index - lowest period (Bio30) 0.01
    Moisture Index - lowest quarter mean (Bio33) 0.03
    Moisture Index - seasonality (Bio31) 101.0
    Moisture Index - warmest quarter mean (Bio34) 0.47
    Nitrogen - plant-available pre-European 1275.932 kgN/ha
    Nitrogen concentration pre-European 25.05336 mgN kg/H2O
    Nitrogen store pre-European 24.77156 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 0.0
    Phosphorus - plant-available pre-European 4.503956 kgP/ha
    Phosphorus - plant-available total pre-European 255.57025 kgP/ha
    Phosphorus pre-European 4.555193 mgP kg/H2O
    Soil depth 0.6 m
    Soil pedality 2.0
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 4.027395
    Unreliable water retention parameters 0.0
    Water deficit - month max 110.24629 mm
    Water deficit - month mean 29.273773 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 59000.0 mm
    Water holding capacity - plant-available 137.0 mm
    Water potential - annual mean -1.169628 MPa
    Water potential - month max -0.018166432 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 34.26606
    Water stress index - month max 81.0
    Water stress index - month min 2.2701843
    Water surplus - annual mean 0.0 mm
    Water surplus - month max 0.0 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 1.71362 Weathering Intensity Index
    Topography
    Aspect 16.0 degrees
    Averaged Topographic Relief 149.20833 metres
    Bathymetry and Topography 9 sec 481.0 m
    Elevation 461.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 1.3241667 degrees
    Topographic relief 55.96533 m
    Topographic roughness 3.337754 %
    Topographic slope (%) 3.043616 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3498 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 52.0 %
    Fractional Cover - Bare Soil (2012-03-05) 1.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 47.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 51.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0197 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.5 m^2 plant / m^2 ground
    NDVI Mean 42.0 NDVI x 100
    NPP Mean 7.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.6117 NDVI
    Phenology peak day of year 2002 dry 80.111115 Day
    Phenology peak day of year 2012 wet 66.77778 Day