Occurrence record: BOLD - Australian records - 3710936

GenomicDNA of Ceramiales recorded on 2009-10-19

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3710936
Other catalogue numbers recordID:1645619;ProcessID:HUWAR030-10;sampleID:RD19.10.9.1.6
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Dixon, R.
Supplied as "R. Dixon"
License CC-BY-Int
Field number RD19.10.9.1.6
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Rainbo Dixon

Event

Field number RD19.10.9.1.6
Record date 2009-10-19
Date precision Day

Taxonomy

Scientific name Ceramiales
Taxon rank order
Kingdom Plantae
Phylum Rhodophyta
Class Florideophyceae
Order Ceramiales
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Locality Montgomery Reef
Latitude -15.897
Longitude 124.326
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession HQ959608
markercode COI-5P
nucleotides TACTTTATACTTAATTTTTGGTGCTTTTTCTGGTGTATTAGGAGGTTGTATGTCAATGTTAATTCGAATGGAATTAGCTCAACCAGGTAATCATTTACTTTTAGGTAATCACCAAGTTTATAATGTTTTAATAACAGCACATGCATTTTTAATGATATTTTTTATGGTTATGCCAGTAATGATCGGTGGTTTTGGTAATTGATTTGTACCAATTATGATTGGAAGCCCAGATATGGCTTTTCCTAGATTAAATAACATTTCTTTTTGGTTGTTACCCCCTTCATTGTGTTTATTACTTTTATCTTCAATTGTAGAAGTAGGTACTGGGACAGGTTGGACTGTTTATCCTCCTTTAAGTTCTATACAAAGTCATTCAGGGGCTTCGGTAGATCTAGCTATTTTTAGTTTACACTTATCAGGAGCTTCATCTATTCTAGGTGCAATTAATTTTATTTCTACAGTTTTAAATATGCGTAATCCAGGACAAACATTCTATAGAATTCCTTTATTTGTTTGATCAATCTTTGTAACTGCATTTTTATTATTATTAGCAGTTCCAGTATTAGCAGGAGCAATAACTATGTTGTTAACTGATAGAAATTTTAATACTTCTTTTTTTGACCCATCAGGAGGAGGTGATCCTATTTTATATCAACATTTATTT
owner institution code Western Australian Herbarium
sequence last updated 2011-11-14T08:11:22Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions Kimberley Coast
    Australian Tropical Savanna Australian Tropical Savanna
    CAPAD 2012 Marine Camden Sound
    CAPAD 2014 Marine Lalang-garram / Camden Sound
    CAPAD 2016 Marine Lalang-garram / Camden Sound
    Global 200 priority ecoregions - Freshwater Kimberley Rivers & Streams
    Global 200 priority ecoregions - Marine Western Australia Marine
    NRM Regions 2010 Rangelands
    NRM Regions 2014 Rangelands
    NRM Regions 2015 Rangelands
    NRM Regions 2017 Rangelands Region
    NRM Regions 2017 (Qld 2019) Rangelands Region
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    IMCRA 4 Regions Northwest Shelf Transition
    IMCRA Meso-scale Bioregions Kimberley
    Marine
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 12.00000000
    Marine Ecoregions of the World Bonaparte Coast
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    Local Government Areas PSMA 2018 SHIRE OF WYNDHAM-EAST KIMBERLEY
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Dambimangari
    Native Title Determinations (13/7/2020) Dambimangari WCD2011/002

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.1668
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 1.9685
    Endemism 0.024936838
    Endemism (Non-marine) 0.030717816
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Occurrence Density 302.0 frequency
    Shannon Diversity (H) 3.26716 index
    Species Richness 78.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 11029.371 m
    Marspec Distance to Shore 9.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.215148 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.78999996 100 x psu
    Marspec Annual Range in Sea Surface Temperature 5.73 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 5.65 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 4.1644 10,000 x degrees C
    Marspec Bathymetric Slope 0.0 10 x degrees
    Marspec Concavity 0.0 1000 x degrees
    Marspec East/West Aspect -0.7 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.36 100 x psu
    Marspec Mean Annual Sea Surface Salinity 34.95 100 x psu
    Marspec Mean Annual Sea Surface Temperature 28.359999 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 34.57 100 x psu
    Marspec North/South Aspect 0.71 1 x radians
    Marspec Plan Curvature 0.0 x 10000
    Marspec Profile Curvature 0.0 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 24.9 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 30.63 100 x degrees C
    Sea Surface Temperature - MODIS Terra 28.732513 Degrees C
    SeaWIFS K490 Mean 0.19143654 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 3.0130749 mg/m^3
    Topography
    Averaged Topographic Relief 27.25 metres
    Bathymetry and Topography 9 sec -8.0 m
    Topographic Slope (degrees) 0.15651627 degrees