Occurrence record:

EnvironmentalDNA of Monoblepharis recorded on 2013-10-26

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2013-10-26
Date precision Day

Taxonomy

Scientific name Monoblepharis
Supplied scientific name "Monoblepharis hypogyna"
Taxon rank genus
Supplied as "species"
Kingdom Fungi
Phylum Chytridiomycota
Class Monoblepharidomycetes
Order Monoblepharidales
Family Monoblepharidaceae
Genus Monoblepharis
Species Monoblepharis hypogyna
Taxonomic issue No issues
Name match metric Higher taxon match
The match is based on the higher level classification.
Name parse type wellformed

Geospatial

Country Australia
State / Province Tasmania
Locality King Island (M)
Locality King Island
Latitude -39.85711
Longitude 143.89846
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 50.0

Additional properties

ammonium nitrogen mg kg 6.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 0.39
broad land use Production from Dryland Agriculture and Plantations
clay 8.71
color GR
conductivity dsm ds m 0.123
course sand 60.51
depth m 0.0
detailed land use Production from Dryland Agriculture and Plantations - Grazing modified pastures - Pasture legume/grass mixtures
dtpa copper mg kg 0.65
dtpa iron mg kg 335.21
dtpa manganese mg kg 6.27
dtpa zinc mg kg 1.43
environment Soil
exc aluminium meq 100g 0.088
exc calcium meq 100g 4.52
exc magnesium meq 100g 0.63
exc potassium meq 100g 0.2
exc sodium meq 100g 0.2
fine sand 24.16
general ecological zone Coastal
gravel 0.0
nitrate nitrogen mg kg 11.0
otu CAAAAGAGACGGCATGAAAAGTTAACTCTTTGACTGCCTGTCCAACCCACACTATGTGAACTGTCTAACGTCTCTGGTAGGCGGATCTCTTTAAAACAGATCCAGGCCAAGCCTTTAAGAGTGTTTGCTCTTTTTGACACTTGACCAACCTGCCATGGGGTTTCGACTCCAACGTTTTAACACTGCGCTGAACCGTCCTAGTCTGAAACGTTAACACTATTAAACAATGTGATAACAACTTTTGACAACGGAT
otucount 30
organic carbon 3.03
ph level cacl2 cacl2 5.1
ph level h2o h2o 6.1
phosphorus colwell mg kg 53.0
potassium colwell mg kg 78.0
sample id 102.100.100/13284
sample type Soil
sand 84.67
silt 6.62
slope 30.0
sulphur mg kg 16.3
texture 2.5
vegetation type Grassland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 12 missing properties
    Show/Hide 44 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Irrigation practice - dominant No irrigation
    Land use Modified pastures
    NRM Regions 2010 North West
    NRM Regions 2014 North West TAS
    NRM Regions 2015 North West
    NRM Regions 2017 North West NRM Region
    NRM Regions 2017 (Qld 2019) North West NRM Region
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 North West NRM Region
    Biodiversity
    Freshwater Ecoregions of the World Bass Strait Drainages
    IBRA 6 Regions King
    IBRA 6 Sub Regions King
    IBRA 7 Regions King
    IBRA 7 Subregions King
    Terrestrial Ecoregional Boundaries Tasmanian Temperate Forests
    World Anthropogenic Biomes (2000) Populated croplands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (mild summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 Tasmania
    Drainage Divisions Level 2 KING ISLAND
    River Regions KING ISLAND
    Marine
    Marine Ecoregions of the World Western Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Braddon
    Local Government Areas 2011 King Island (M)
    Local Government Areas 2012 deprecated King Island
    Local Government Areas PSMA 2018 KING ISLAND COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3932
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF TAS.
    PSMA ABS SA2 Statistical Areas (2016) KING ISLAND
    PSMA ABS SA3 Statistical Areas (2016) WEST COAST
    PSMA ABS SA4 Statistical Areas (2016) WEST AND NORTH WEST
    PSMA Commonwealth Electoral Boundaries (2016) BRADDON
    PSMA Commonwealth Electoral Boundaries (2018) BRADDON
    PSMA Indigenous Areas (2016) TASMANIA - WEST COAST
    PSMA Indigenous Locations (2016) CIRCULAR HEAD - KING ISLAND
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) LOORANA
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (TAS.)
    PSMA State Electoral Boundaries (2016) BRADDON
    PSMA State Electoral Boundaries (2018) MURCHISON
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas King Island (M)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia King Island Region
    Surface Geology of Australia Qdc
    Topography
    Physiographic Provinces of Australia Tasmanian Uplands Province
    Physiographic Regions 2011 Bass Islands
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 861341.0 dse
    Dairy numbers 166998.0 dse
    Dolomite (acidity) 2.0 t/ha
    Lime 5.0 t/ha
    Natural resource management expenditure 4058626.0 $
    Natural resource management expenditure - additional 1.0 $/ha
    Nitrogen 0.05488 t/ha
    Sheep numbers 24653.0 dse
    Area management
    Phosphorus 0.023799 t/ha
    Potassium 0.073298 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.2249
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.7367
    Endemism 0.017763533
    Endemism (Non-marine) 0.020885983
    Mammals – Fritz et al 2009 - 0.5 degree 0.4126
    Migratory species (2008) 4.0 frequency
    Occurrence Density 6780.0 frequency
    Shannon Diversity (H) 4.730398 index
    Species Richness 975.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 4.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.9064692
    2030A1BMk35M: Aridity index - month max 2.001977
    2030A1BMk35M: Aridity index - month min 0.19580328
    2030A1BMk35M: Evaporation - annual mean 103.92917 mm
    2030A1BMk35M: Evaporation - month max 173.9 mm
    2030A1BMk35M: Evaporation - month min 55.64 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.05 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.39 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.04 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 87.835686 %
    2030A1BMk35M: Humidity - month max relative 3pm 89.14564 %
    2030A1BMk35M: Humidity - month min relative 3pm 86.77948 %
    2030A1BMk35M: Precipitation - annual mean 70.27583 mm
    2030A1BMk35M: Precipitation - driest month 29.86 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1111052
    2030A1BMk35M: Precipitation - max difference between successive months 1.005086 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.8801507 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.34689775
    2030A1BMk35M: Precipitation - spring or autumn season 0.110523485
    2030A1BMk35M: Precipitation - summer or winter season -1.8663069
    2030A1BMk35M: Precipitation - wettest month 112.08 mm
    2030A1BMk35M: Precipitation deficit - annual mean -33.653336 mm
    2030A1BMk35M: Precipitation deficit - month max -134.69 mm
    2030A1BMk35M: Precipitation deficit - month min 55.75 mm
    2030A1BMk35M: Radiation - max month precipitation modified 24.37 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 14.253333 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 4.94 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 17.501667 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.069166 degrees C
    2030A1BMk35M: Temperature - annual range 13.160004 degrees C
    2030A1BMk35M: Temperature - coldest month min 8.58 degrees C
    2030A1BMk35M: Temperature - coolest month max 13.83 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.6499939 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.2399902 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 7.6600037 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 6.4324975 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.1500244 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.480011 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 5.200012 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 21.74 degrees C
    2030A1BMk35M: Temperature - warmest month min 14.08 degrees C
    Aridity index - annual mean 1.3631371
    Aridity index - month max 3.3593445
    Aridity index - month min 0.22617891
    Evaporation - annual mean 91.46141 (ml/5km x 5km pixel)
    Evaporation - average 14043.0 ml
    Evaporation - month max 172.42987 mm
    Evaporation - month min 33.229877 mm
    Evaporation - variability 7.0 %
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.37 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 88.27454 %
    Humidity - annual mean relative 3pm 87.04117 %
    Humidity - month max relative 90.97531 %
    Humidity - month max relative 3pm 88.205376 %
    Humidity - month min relative 85.23034 %
    Humidity - month min relative 3pm 85.98538 %
    Precipitation - annual 940.0 mm
    Precipitation - annual (Bio12) 915.0 mm
    Precipitation - annual (log) seasonality index -0.107085444
    Precipitation - annual mean 80.03594 mm
    Precipitation - annual seasonality -0.8643788
    Precipitation - annual seasonality ratio 0.5356304
    Precipitation - autumn 231.0 mm
    Precipitation - autumn reliability 59.0 %
    Precipitation - coldest quarter (Bio19) 346.0 mm
    Precipitation - driest month 39.0 mm
    Precipitation - driest period (Bio14) 8.0 mm
    Precipitation - driest quarter (Bio17) 124.0 mm
    Precipitation - equinox seasonality ratio 1.0056297
    Precipitation - max difference between successive months 0.8236559 mm/day
    Precipitation - min difference between successive months -1.0359492 mm/day
    Precipitation - seasonality (Bio15) 39.0 mm
    Precipitation - solstice seasonality ratio 0.37978533
    Precipitation - spring 233.0 mm
    Precipitation - spring or autumn (log) season 0.0010265026
    Precipitation - spring or autumn season 0.0056054187
    Precipitation - spring reliability 77.0 %
    Precipitation - summer 137.0 mm
    Precipitation - summer or winter (log) season -0.1955744
    Precipitation - summer or winter season -1.6212326
    Precipitation - summer reliability 54.0 %
    Precipitation - warmest quarter (Bio18) 125.0 mm
    Precipitation - wettest month 131.01443 mm
    Precipitation - wettest period (Bio13) 30.0 mm
    Precipitation - wettest quarter (Bio16) 349.0 mm
    Precipitation - winter 363.0 mm
    Precipitation - winter reliability 81.0 %
    Precipitation deficit - annual mean -11.425469 mm
    Precipitation deficit - month max -133.42987 mm
    Precipitation deficit - month min 92.014435 mm
    Radiation - annual mean (Bio20) 14.1 MJ/m2/day
    Radiation - coldest quarter (Bio27) 6.8 MJ/m2/day
    Radiation - driest quarter (Bio25) 22.0 MJ/m2/day
    Radiation - highest period (Bio21) 24.6 MJ/m2/day
    Radiation - lowest period (Bio22) 4.7 MJ/m2/day
    Radiation - max month precipitation modified 24.4 MJ/m2/day
    Radiation - mean annual precipitation modified 13.975 MJ/m2/day
    Radiation - min month precipitation modified 4.9 MJ/m2/day
    Radiation - seasonality (Bio23) 51.0
    Radiation - warmest quarter (Bio26) 21.3 MJ/m2/day
    Radiation - wettest quarter (Bio24) 6.4 MJ/m2/day
    Temperature - annual max mean 15.821667 degrees C
    Temperature - annual mean (Bio01) 13.5 degrees C
    Temperature - annual min mean 9.780833 degrees C
    Temperature - annual range 13.800018 degrees C
    Temperature - annual range (Bio07) 13.3 degrees C
    Temperature - coldest month min 7.32 degrees C
    Temperature - coldest period min (Bio06) 7.7 degrees C
    Temperature - coldest quarter mean (Bio11) 10.7 degrees C
    Temperature - coolest month max 12.29 degrees C
    Temperature - diurnal range mean (Bio02) 6.4 degrees C
    Temperature - driest quarter mean (Bio09) 16.5 degrees C
    Temperature - isothermality (Bio03) 0.48 %
    Temperature - max absolute mean max 37.0 degrees C
    Temperature - max difference in max 1.5699768 degrees C/day
    Temperature - max difference in min 1.3900146 degrees C/day
    Temperature - max month diurnal range 7.3299866 degrees C
    Temperature - mean annual absolute mean min 3.273349 degrees C
    Temperature - mean annual diurnal range 6.0408325 degrees C
    Temperature - min absolute mean min -0.7131008 degrees C
    Temperature - min difference in max -2.2900085 degrees C/day
    Temperature - min difference in min -1.4499817 degrees C/day
    Temperature - min month diurnal range 4.7599792 degrees C
    Temperature - month hottest maximum 19.76 degrees C
    Temperature - month mean absolute max 30.264223 degrees C
    Temperature - seasonality (Bio04) 0.8
    Temperature - warmest month min 12.8 degrees C
    Temperature - warmest period max (Bio05) 21.0 degrees C
    Temperature - warmest quarter (Bio10) 16.6 degrees C
    Temperature - wettest quarter mean (Bio08) 10.8 degrees C
    Vapour pressure deficit - annual mean 0.076777615 KPa
    Vapour pressure deficit - annual mean 9am 0.14511564 KPa
    Vapour pressure deficit - month max 0.22847462 KPa
    Vapour pressure deficit - month max 9am 0.22847462 KPa
    Vapour pressure deficit - month min 0.036252618 KPa
    Vapour pressure deficit - month min 9am 0.08950925 KPa
    Wind run - annual mean 184.1888 km/day
    Wind run - month max 205.79294 km/day
    Wind run - month min 161.99294 km/day
    Wind speed - annual mean 3pm 3.7583332 m/s
    Wind speed - annual mean 9am 2.675 m/s
    Wind speed - annual mean 9am or 3pm 3.75 m/s
    Wind speed - month max 3pm 4.2 m/s
    Wind speed - month max 9am 3.3 m/s
    Wind speed - month max 9am or 3pm 4.2 m/s
    Wind speed - month min 3pm 3.1 m/s
    Wind speed - month min 9am 2.0 m/s
    Wind speed - month min 9am or 3pm 2.0 m/s
    WorldClim: Precipitation - annual 981.0 mm
    WorldClim: Precipitation - coldest quarter 372.0 mm
    WorldClim: Precipitation - driest month 34.0 mm
    WorldClim: Precipitation - driest quarter 124.0 mm
    WorldClim: Precipitation - seasonality 40.0
    WorldClim: Precipitation - warmest quarter 126.0 mm
    WorldClim: Precipitation - wettest month 135.0 mm
    WorldClim: Precipitation - wettest quarter 372.0 mm
    WorldClim: Temperature - annual mean 133.0 degrees C * 10
    WorldClim: Temperature - annual range 134.0 degrees C * 10
    WorldClim: Temperature - coldest month min 74.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 103.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 65.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 161.0 degrees C * 10
    WorldClim: Temperature - isothermality 48.0 %
    WorldClim: Temperature - seasonality 2413.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 208.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 166.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 103.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.06 degrees
    Distance - to coast 0.08062258 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.06 km
    Euclidean Distance to Coast (metres) 1601.2378 m
    Remoteness index 15.84
    Hydrology
    Drainage - average 4994.0 megalitres/5x5km/year
    Drainage - variability 16.0 %
    Runoff - average 2430.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Age 41.5 years
    Age - prime group 26.8 Count
    Disadvantaged 995.782 points (mean=1000)
    Education - degrees 8.6 %
    Education - vocational training 27.9 %
    Employment 29.7 %
    Home ownership 62.8 %
    Income - high 26.6 %
    Income - low 15.0 %
    Internet 44.6 %
    Population - change -0.7 count
    Population - density SLA 2006 p/sqkm) 1.5 people/km^2
    Unemployment rate 1.7 %
    Work force - older 28.5 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.65942794
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.19580328
    2030A1BMk35M: Water deficit - month max 100.08898 mm
    2030A1BMk35M: Water deficit - month mean 29.831234 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.77759075 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 59.34851
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 17.622295
    2030A1BMk35M: Water surplus - annual mean 11.9210825 mm
    2030A1BMk35M: Water surplus - month max 61.313995 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 30.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.4 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 2.0 %
    Bouguer gravity anomalies 269.2163 Gal
    Bulk density 1.1999999 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.8785587 %
    Carbon store pre-European 76.68508 kgC/ha
    Clay % 8.25 %
    Crop factor - annual mean 0.7275494
    Crop factor - month max 0.9
    Crop factor - month min 0.22617891
    Erodibility 8.0 k factor
    Erosional surfaces - proportion 37.5 %
    Erosivity 842.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 214.2857 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 2.588 my
    Lithology - fertility 2.0 index
    Lithology - mean age 1.294 my
    Lithology - mean age (log) 0.11193429 log my
    Lithology - mean age range (log) 0.41296428 log my
    Magnetic anomalies -104.0 nT
    Moisture - average 65.0 %
    Moisture - variability 7.0 %
    Moisture Index - annual mean (Bio28) 0.75
    Moisture Index - coldest quarter mean (Bio35) 1.0
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.21
    Moisture Index - lowest quarter mean (Bio33) 0.3
    Moisture Index - seasonality (Bio31) 39.0
    Moisture Index - warmest quarter mean (Bio34) 0.32
    Nitrogen - plant-available pre-European 6432.175 kgN/ha
    Nitrogen concentration pre-European 53.97739 mgN kg/H2O
    Nitrogen store pre-European 55.28026 kgN/ha
    Nutrient status 1.4 index
    Pedality hydrological score 1.25
    Phosphorus - plant-available pre-European 10.15362 kgP/ha
    Phosphorus - plant-available total pre-European 1151.387 kgP/ha
    Phosphorus pre-European 9.914314 mgP kg/H2O
    Soil depth 0.5 m
    Soil pedality 1.25
    Soils - coarse 0.0 class
    Substrate data reliability 3.0
    Topographic wetness index 5.311993
    Unreliable water retention parameters 0.0
    Water deficit - month max 98.88687 mm
    Water deficit - month mean 22.938734 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 47000.0 mm
    Water holding capacity - plant-available 69.0 mm
    Water potential - annual mean -0.5972423 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 65.47945
    Water stress index - month max 81.0
    Water stress index - month min 20.356102
    Water surplus - annual mean 23.38495 mm
    Water surplus - month max 95.91443 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 3.49344 Weathering Intensity Index
    Topography
    Aspect 198.0 degrees
    Averaged Topographic Relief 26.291666 metres
    Bathymetry and Topography 9 sec 35.0 m
    Elevation 43.0 m
    Ridge top flatness 1.609767
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 0.090711586 degrees
    Topographic relief 5.628975 m
    Topographic roughness 3.598511 %
    Topographic slope (%) 0.4108226 %
    Valley bottom % 18.75 %
    Valley bottom flatness index 2.794818
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3382 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 22.0 %
    Fractional Cover - Bare Soil (2012-03-05) 7.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 42.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 51.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NPP Mean 13.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.6108 NDVI
    Phenology peak day of year 2002 dry 259.13333 Day
    Phenology peak day of year 2012 wet 259.13333 Day