Occurrence record: BOLD - Australian records - 3398506

GenomicDNA of LEPIDOPTERA | Moths recorded on 2003-12-08

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3398506
Other catalogue numbers recordID:1140891;ProcessID:ANICC277-09;sampleID:ANIC Gen No. 003439
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Lane, D.A.
Supplied as "D.A. Lane"
Life stage adult
License CC-BY-Int
Field number 3439
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Edward D. Edwards

Event

Field number 3439
Record date 2003-12-08
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Dimbulah

Additional properties

genbank accession GU688829
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGAATTTGAGCTGGAATAGTTGGAACTTCTTTAAGACTTTTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGACCAAATTTATAATACTATTGTAACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAACTGATTAGTCCCGTTAATATTAGGAGCCCCTGATATAGCTTTCCCACGAATAAATAATATAAGTTTTTGACTTCTACCCCCTTCTTTAACTCTCTTAATCTCTAGTAGAATTGTAGAAAATGGAGCCGGAACAGGATGAACAGTCTATCCCCCTCTTTCCTCTAATATTGCCCATGGAGGAACTTCTGTAGACTTAGCTATTTTTTCTCTTCATCTTGCAGGTATTTCATCAATTTTAGGTGCAATTAATTTTATTACAACAATTATTAATATACGAATAAATAATTTATCATTTGATCAAATACCTTTATTTGTCTGAGCAGTGGGAATTACAGCTTTTCTTCTTCTTTTATCCCTTCCTGTTTTAGCTGGGGCTATTACTATATTATTAACTGATCGAAACCTTAATACTTCCTTTTTTGACCCTGCTGGAGGGGGAGACCCTATCCTCTATCAACATCTTTTC
owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:42Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 56 tests that have not been run