Occurrence record:

EnvironmentalDNA of Monoblepharidomycetes recorded on 2014-12-10

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07488624
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-12-10
Date precision Day

Taxonomy

Scientific name Monoblepharidomycetes
Taxon rank class
Kingdom Fungi
Phylum Chytridiomycota
Class Monoblepharidomycetes
Order unclassified Monoblepharidomycetes
Family unclassified Monoblepharidomycetes
Genus unclassified Monoblepharidomycetes
Species Monoblepharidomycetes sp
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province South Australia
Locality Yankalilla (DC)
Locality Fisheries Beach
Latitude -35.635311
Longitude 138.120931
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 50.0

Additional properties

ammonium nitrogen mg kg 1.0
amplicon ITS1FITS4_fungi
australian soil classification Sodosols
boron hot cacl2 mg kg 2.03
broad land use Conservation and Natural Environments
clay 36.65
color DKBR
conductivity dsm ds m 0.151
course sand 10.06
depth m 0.0
detailed land use Conservation and Natural Environments - Nature conservation - Other conserved area
dtpa copper mg kg 0.8
dtpa iron mg kg 30.48
dtpa manganese mg kg 14.92
dtpa zinc mg kg 0.21
environment Soil
exc aluminium meq 100g 0.031
exc calcium meq 100g 16.94
exc magnesium meq 100g 2.89
exc potassium meq 100g 2.58
exc sodium meq 100g 0.5
fine sand 39.0
general ecological zone Coastal
gravel 5.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07488624
nitrate nitrogen mg kg 60.0
otu CAAAAGAGACCAAGTTCAGTGCCCAAGACTCTCTTGAAACAGGTCCTGGGCCTGTTCTTTAGTCCCCACCCACACTTTGTGAACTGTTGACTGTCTCTGGCAGTTTTGCTCTAAAGTTGTCATCCTTTTCAGGTGACAATTTTAAAACAGGCTGCCGAAGGGGGGGGTCCTCCATTGTTGACTCCTCATTATTTCTAACTCTATGCTTAACATTACCGGTCTGAAACTCTTCATATTATAAAATGTGAAAACAA
otucount 16
organic carbon 3.14
ph level cacl2 cacl2 6.2
ph level h2o h2o 6.9
phosphorus colwell mg kg 6.0
potassium colwell mg kg 925.0
sample id 102.100.100/19263
sample type Soil
sand 49.06
silt 14.29
slope 8.0
soil moisture 12.38
sulphur mg kg 10.4
texture 2.0
vegetation type Woodland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    NRM Regions 2010 Adelaide and Mount Lofty Ranges
    NRM Regions 2014 Adelaide and Mount Lofty Ranges
    NRM Regions 2015 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 (Qld 2019) Adelaide and Mount Lofty Ranges
    Area management
    National Landcare Program Management Units 2018 Adelaide and Mount Lofty Ranges
    Biodiversity
    IBRA 6 Regions Kanmantoo
    IBRA 6 Sub Regions Fleurieu
    IBRA 7 Regions Kanmantoo
    IBRA 7 Subregions Fleurieu
    Terrestrial Ecoregional Boundaries Mount Lofty Woodlands
    World Anthropogenic Biomes (2000) Populated croplands
    Climate
    Agroclimatic classification of Australia Classic "Mediterranean" climate with peaks of growth in winter and spring and moderate growth in winter
    Koppen Climate Classification (All Classes) Temperate: distinctly dry (and warm) summer
    Koppen Climate Classification (Major Classes) Temperate
    Hydrology
    Drainage Divisions Level 1 South Australian Gulf
    Drainage Divisions Level 2 FLEURIEU PENINSULA
    River Regions FLEURIEU PENINSULA
    Marine
    Geomorphology of the Australian Margin and adjacent seafloor Sandwave/sandbank
    Marine Ecoregions of the World Western Bassian
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Mayo
    Local Government Areas 2011 Yankalilla (DC)
    Local Government Areas 2012 deprecated Yankalilla
    Local Government Areas PSMA 2018 THE DC OF YANKALILLA
    Native Title Determinations (13/7/2020) Ngarrindjeri and Others Native Title Claim SCD2017/002
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 28
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 717
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF SA
    PSMA ABS SA2 Statistical Areas (2016) YANKALILLA
    PSMA ABS SA3 Statistical Areas (2016) FLEURIEU - KANGAROO ISLAND
    PSMA ABS SA4 Statistical Areas (2016) SOUTH AUSTRALIA - SOUTH EAST
    PSMA Commonwealth Electoral Boundaries (2016) MAYO
    PSMA Commonwealth Electoral Boundaries (2018) MAYO
    PSMA Indigenous Areas (2016) FLEURIEU - KANGAROO ISLAND
    PSMA Indigenous Locations (2016) FLEURIEU - KANGAROO ISLAND
    PSMA Indigenous Regions (2016) ADELAIDE
    PSMA Localities (2018) CAPE JERVIS
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (SA)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (SA)
    PSMA Wards (2018) FIELD WARD
    Statistical Local Areas Yankalilla (DC)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Kanmantoo Region
    Surface Geology of Australia -Cykk
    Topography
    Physiographic Provinces of Australia Gulfs Ranges Province
    Physiographic Regions 2011 Flinders-Lofty Ranges
    Vegetation
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 7775071.0 $
    Area management
    Phosphorus 377.78043 t/ha
    Potassium 377.81195 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8556
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.8347
    Endemism 0.015186212
    Endemism (Non-marine) 0.017245036
    Mammals – Fritz et al 2009 - 0.5 degree 0.2691
    Migratory species (2008) 13.0 frequency
    Occurrence Density 45176.0 frequency
    Shannon Diversity (H) 5.337476 index
    Species Richness 2057.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 7.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.49714333
    2030A1BMk35M: Evaporation - month min 55.99 mm
    2030A1BMk35M: Precipitation - annual mean 41.335 mm
    2030A1BMk35M: Precipitation - driest month 13.37 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0918498
    2030A1BMk35M: Precipitation - spring or autumn season 0.09101632
    2030A1BMk35M: Temperature - annual max mean 19.9625 degrees C
    2030A1BMk35M: Temperature - annual min mean 12.5575 degrees C
    2030A1BMk35M: Temperature - annual range 15.490021 degrees C
    Aridity index - annual mean 0.6214964
    Aridity index - month max 1.7098354
    Aridity index - month min 0.09322132
    Evaporation - annual mean 129.35751 (ml/5km x 5km pixel)
    Evaporation - month max 239.03061 mm
    Evaporation - month min 48.035103 mm
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.28 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 81.494736 %
    Humidity - annual mean relative 3pm 75.643456 %
    Humidity - month max relative 87.736465 %
    Humidity - month max relative 3pm 83.1667 %
    Humidity - month min relative 67.95995 %
    Humidity - month min relative 3pm 67.95995 %
    Precipitation - annual 535.0 mm
    Precipitation - annual (Bio12) 557.0 mm
    Precipitation - annual mean 48.06478 mm
    Precipitation - annual seasonality -1.6054851
    Precipitation - coldest quarter (Bio19) 242.0 mm
    Precipitation - driest month 19.282747 mm
    Precipitation - driest period (Bio14) 4.0 mm
    Precipitation - driest quarter (Bio17) 55.0 mm
    Precipitation - equinox seasonality ratio 0.9978502
    Precipitation - seasonality (Bio15) 56.0 mm
    Precipitation - spring or autumn season -0.002138171
    Precipitation - warmest quarter (Bio18) 55.0 mm
    Precipitation - wettest month 90.244156 mm
    Precipitation - wettest period (Bio13) 21.0 mm
    Precipitation - wettest quarter (Bio16) 249.0 mm
    Radiation - annual mean (Bio20) 16.9 MJ/m2/day
    Radiation - seasonality (Bio23) 43.0
    Radiation - warmest quarter (Bio26) 24.9 MJ/m2/day
    Temperature - annual max mean 18.505 degrees C
    Temperature - annual mean (Bio01) 15.5 degrees C
    Temperature - annual min mean 11.0375 degrees C
    Temperature - annual range 15.916077 degrees C
    Temperature - annual range (Bio07) 15.8 degrees C
    Temperature - coldest month min 7.82 degrees C
    Temperature - coldest period min (Bio06) 8.3 degrees C
    Temperature - coldest quarter mean (Bio11) 11.8 degrees C
    Temperature - diurnal range mean (Bio02) 7.3 degrees C
    Temperature - driest quarter mean (Bio09) 19.2 degrees C
    Temperature - isothermality (Bio03) 0.46 %
    Temperature - month hottest maximum 23.0 degrees C
    Temperature - seasonality (Bio04) 1.02
    Temperature - warmest month min 14.84 degrees C
    Temperature - warmest period max (Bio05) 24.1 degrees C
    Temperature - warmest quarter (Bio10) 19.3 degrees C
    Temperature - wettest quarter mean (Bio08) 11.9 degrees C
    Wind run - annual mean 338.95572 km/day
    WorldClim: Precipitation - annual 506.0 mm
    WorldClim: Precipitation - coldest quarter 223.0 mm
    WorldClim: Precipitation - driest month 13.0 mm
    WorldClim: Precipitation - driest quarter 46.0 mm
    WorldClim: Precipitation - seasonality 54.0
    WorldClim: Precipitation - warmest quarter 46.0 mm
    WorldClim: Precipitation - wettest month 79.0 mm
    WorldClim: Precipitation - wettest quarter 223.0 mm
    WorldClim: Temperature - annual mean 157.0 degrees C * 10
    WorldClim: Temperature - annual range 151.0 degrees C * 10
    WorldClim: Temperature - coldest month min 87.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 120.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 72.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 194.0 degrees C * 10
    WorldClim: Temperature - isothermality 47.0 %
    WorldClim: Temperature - seasonality 2917.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 238.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 194.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 120.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.01 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.17464249 km
    Euclidean Distance to Coast (metres) 1338.1715 m
    Remoteness index 3.7228062
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.0 Pascals
    Sea Surface Temperature - MODIS Terra 16.83818 Degrees C
    SeaWIFS K490 Mean 0.09581159 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.7328368 mg/m^3
    Social
    Population - density SLA 2006 p/sqkm) 5.5 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 85.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.35 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 28.0 %
    Bulk density 1.5384234 Mg/m^3
    Carbon - organic 1.2817262 %
    Clay % 50.61036 %
    Hydrologic conductivity - average saturated 13.333333 mm/h
    Moisture Index - annual mean (Bio28) 0.51
    Moisture Index - highest quarter mean (Bio32) 0.97
    Nutrient status 2.0 index
    Soil depth 1.2 m
    Soil pedality 3.8342342
    Water holding capacity 19000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 4.31072 Weathering Intensity Index
    Topography
    Aspect 264.0 degrees
    Averaged Topographic Relief 270.875 metres
    Bathymetry and Topography 9 sec 48.0 m
    Elevation 77.0 m
    Topographic Slope (degrees) 2.6194782 degrees
    Topographic relief 59.16549 m
    Topographic slope (%) 4.092267 %
    Vegetation
    Fractional Cover - Bare Soil (2012-03-05) 23.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 56.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 21.0 % Persistent Vegetation
    NPP Mean 6.0 tonnes/ha/yr