We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3733675

GenomicDNA of LEPIDOPTERA | Moths recorded on 1971-04-12

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3733675
Other catalog numbers recordID:1646973;ProcessID:ANICF289-10;sampleID:10ANIC-02286
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Upton, M. Mitchell
Supplied as "Upton, Mitchell"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Occurrence date 1971-04-12
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Locality Ashburton (S)
Locality 5km SE Millstream HS
Latitude -21.617
Longitude 117.1
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ921973
markercode COI-5P
nucleotides AACTCTATATTTCATTTTTGGAATTTGATCTGGAATAGTAGGAACATCCTTAAGATTATTAATTCGAGCAGAATTAGGAAATCCTGGATCTTTAATTGGTGATGATCAAATTTATAATACTATTGTAACAGCACATGCTTTTATCATAATCTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCATTAATATTAGGTGCACCAGATATAGCTTTCCCACGAATAAATAATATAAGATTTTGATTATTACCCCCATCATTAATACTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCAGGAACAGGATGAACAGTATATCCCCCACTTTCATCAAATATTGCACATAGAGGAAGATCAGTAGATCTTGCTATTTTTTCTCTACACTTAGCTGGAATTTCATCTATTTTAGGAGCTATTAATTTTATTACAACAATTATTAACATACGACCAAATAAAATATCTTTTGACCAAATACCATTATTTGTGTGAGCAGTTAATATTACAGCCTTACTTCTTTTATTATCATTACCTGTATTAGCTGGAGCTATTACAATATTATTAACTGATCGAAATTTAAATACATCATTTTTTGATCCAGCAGGAGGAGGAGATCCTATTCTTTACCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:43Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Terrestrial Carnavon Xeric Shrubs
    Irrigation practice - dominant No irrigation
    Land use Grazing of native pastures
    NRM Regions 2010 Rangelands
    NRM Regions 2014 Rangelands
    NRM Regions 2015 Rangelands
    NRM Regions 2017 Rangelands Region
    NRM Regions 2017 (Qld 2019) Rangelands Region
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    Freshwater Ecoregions of the World Pilbara
    IBRA 6 Regions Pilbara
    IBRA 6 Sub Regions Fortescue
    IBRA 7 Regions Pilbara
    IBRA 7 Subregions Fortescue
    Terrestrial Ecoregional Boundaries Pilbara Shrublands
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Desert, supporting very little plant growth due to water limitation
    Koppen Climate Classification (All Classes) Grassland: hot (summer drought)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Hummock grassland (semi-arid/arid)
    Hydrology
    Drainage Divisions Level 1 Pilbara-Gascoyne
    Drainage Divisions Level 2 FORTESCUE RIVER
    River Regions FORTESCUE RIVER
    Land Management
    Western Australian Biodiversity Science Research Priority Regions Pilbara
    Marine
    Marine Ecoregions of the World Exmouth to Broome
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Commonwealth Electoral Boundaries Durack
    Local Government Areas 2011 Ashburton (S)
    Local Government Areas 2012 deprecated Ashburton
    Local Government Areas PSMA 2018 SHIRE OF ASHBURTON
    National Native Title Register (NNTR, Determinations of Native Title) - boundaries and core attributes Ngarluma/Yindjibarndi
    Native Title Determinations (13/7/2020) Ngarluma/Yindjibarndi WCD2005/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 179
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1082
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) ASHBURTON (WA)
    PSMA ABS SA3 Statistical Areas (2016) WEST PILBARA
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - OUTBACK (NORTH)
    PSMA Commonwealth Electoral Boundaries (2016) DURACK
    PSMA Commonwealth Electoral Boundaries (2018) DURACK
    PSMA Indigenous Areas (2016) EXMOUTH - ASHBURTON
    PSMA Indigenous Locations (2016) EXMOUTH - ASHBURTON - SURROUNDS
    PSMA Indigenous Regions (2016) SOUTH HEDLAND
    PSMA Localities (2018) MILLSTREAM
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (WA)
    PSMA State Electoral Boundaries (2016) MINING AND PASTORAL REGION
    PSMA State Electoral Boundaries (2018) MINING AND PASTORAL REGION
    PSMA States (2016) WESTERN AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (WA)
    PSMA Wards (2018) TABLELAND WARD
    Statistical Local Areas Ashburton (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Hamersley Region
    Surface Geology of Australia Czims
    Topography
    Physiographic Provinces of Australia Pilbara Province
    Physiographic Regions 2011 Fortescue Valley
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native grasslands and minimally modified pastures
    NVIS 4.1 Major Vegetation Groups Hummock Grasslands
    NVIS 4.1 Major Vegetation Subgroups Acacia (+/- low) open woodlands and sparse shrublands with hummock grass
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Transformed
    Vegetation types - native Hummock grasslands
    Vegetation types - present Hummock grasslands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 6180020.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.7504
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 1.9862
    Endemism 0.039100844
    Endemism (Non-marine) 0.040812746
    Mammals – Fritz et al 2009 - 0.5 degree 0.2564
    Migratory species (2008) 3.0 frequency
    Occurrence Density 1103.0 frequency
    Shannon Diversity (H) 4.86125 index
    Species Richness 286.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 2.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.104929835
    2030A1BMk35M: Evaporation - month min 164.39 mm
    2030A1BMk35M: Precipitation - annual mean 30.159166 mm
    2030A1BMk35M: Precipitation - driest month 0.0 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.04164051
    2030A1BMk35M: Precipitation - spring or autumn season -18.393574
    2030A1BMk35M: Temperature - annual max mean 34.955 degrees C
    2030A1BMk35M: Temperature - annual min mean 20.224167 degrees C
    2030A1BMk35M: Temperature - annual range 27.919983 degrees C
    Aridity index - annual mean 0.107900366
    Aridity index - month max 0.3023361
    Aridity index - month min 0.00371789
    Evaporation - annual mean 276.69977 (ml/5km x 5km pixel)
    Evaporation - average 9319.0 ml
    Evaporation - month max 384.28195 mm
    Evaporation - month min 155.16975 mm
    Evaporation - variability 29.0 %
    Growth index C3 macrotherm plants - annual mean 0.08 index
    Growth index C3 mesotherm plants - annual mean 0.04 index
    Growth index C4 megatherm plants - annual mean 0.08 index
    Humidity - annual mean relative 57.490704 %
    Humidity - annual mean relative 3pm 44.495075 %
    Humidity - month max relative 66.99261 %
    Humidity - month max relative 3pm 53.414932 %
    Humidity - month min relative 37.362816 %
    Humidity - month min relative 3pm 37.362816 %
    Precipitation - annual 355.0 mm
    Precipitation - annual (Bio12) 397.0 mm
    Precipitation - annual mean 29.75 mm
    Precipitation - annual seasonality 1.6632653
    Precipitation - coldest quarter (Bio19) 58.0 mm
    Precipitation - driest month 1.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 6.0 mm
    Precipitation - equinox seasonality ratio 0.1122449
    Precipitation - seasonality (Bio15) 105.0 mm
    Precipitation - spring or autumn season -7.25
    Precipitation - warmest quarter (Bio18) 227.0 mm
    Precipitation - wettest month 90.0 mm
    Precipitation - wettest period (Bio13) 30.0 mm
    Precipitation - wettest quarter (Bio16) 254.0 mm
    Radiation - annual mean (Bio20) 22.5 MJ/m2/day
    Radiation - seasonality (Bio23) 23.0
    Radiation - warmest quarter (Bio26) 26.4 MJ/m2/day
    Temperature - annual max mean 32.666668 degrees C
    Temperature - annual mean (Bio01) 26.2 degrees C
    Temperature - annual min mean 18.516666 degrees C
    Temperature - annual range 33.681946 degrees C
    Temperature - annual range (Bio07) 28.8 degrees C
    Temperature - coldest month min 11.08 degrees C
    Temperature - coldest period min (Bio06) 11.0 degrees C
    Temperature - coldest quarter mean (Bio11) 19.4 degrees C
    Temperature - diurnal range mean (Bio02) 14.5 degrees C
    Temperature - driest quarter mean (Bio09) 26.1 degrees C
    Temperature - isothermality (Bio03) 0.5 %
    Temperature - month hottest maximum 38.64 degrees C
    Temperature - seasonality (Bio04) 1.67
    Temperature - warmest month min 24.6 degrees C
    Temperature - warmest period max (Bio05) 39.8 degrees C
    Temperature - warmest quarter (Bio10) 31.8 degrees C
    Temperature - wettest quarter mean (Bio08) 31.4 degrees C
    Wind run - annual mean 172.08595 km/day
    WorldClim: Precipitation - annual 351.0 mm
    WorldClim: Precipitation - coldest quarter 53.0 mm
    WorldClim: Precipitation - driest month 2.0 mm
    WorldClim: Precipitation - driest quarter 10.0 mm
    WorldClim: Precipitation - seasonality 92.0
    WorldClim: Precipitation - warmest quarter 179.0 mm
    WorldClim: Precipitation - wettest month 93.0 mm
    WorldClim: Precipitation - wettest quarter 213.0 mm
    WorldClim: Temperature - annual mean 264.0 degrees C * 10
    WorldClim: Temperature - annual range 282.0 degrees C * 10
    WorldClim: Temperature - coldest month min 116.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 194.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 146.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 236.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 4969.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 398.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 320.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 316.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.9198369 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.01 km
    Euclidean Distance to Coast (metres) 82478.09 m
    Remoteness index 15.680074
    Fire
    Fire - time since last 3.0 years
    Fire frequency 1.0 frequency
    Hydrology
    Drainage - average 18.0 megalitres/5x5km/year
    Drainage - variability 292.0 %
    Runoff - average 957.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.1 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 33.113014
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 91.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.41 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 22.0 %
    Bulk density 1.2478261 Mg/m^3
    Carbon - organic 0.25343964 %
    Clay % 33.391304 %
    Hydrologic conductivity - average saturated 40.0 mm/h
    Moisture Index - annual mean (Bio28) 0.12
    Moisture Index - highest quarter mean (Bio32) 0.26
    Nutrient status 1.25 index
    Soil depth 0.6 m
    Soil pedality 2.3594203
    Water holding capacity 35000.0 mm
    Water stress index - month max 27.210249
    Weathering Intensity V2 5.39651 Weathering Intensity Index
    Topography
    Aspect 61.0 degrees
    Averaged Topographic Relief 34.625 metres
    Bathymetry and Elvation 9 sec 293.0 m
    Elevation 292.0 m
    Topographic Slope (degrees) 0.35041475 degrees
    Topographic relief 7.269562 m
    Topographic slope (%) 0.3933723 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1357 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 19.0 %
    Fractional Cover - Bare Soil (2012-03-05) 5.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 76.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 19.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0049 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NDVI Mean 20.0 NDVI x 100
    NPP Mean 0.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.2559 NDVI