Occurrence record: BOLD - Australian records - 3441281

GenomicDNA of Phasmatodea recorded on 1969-12-31

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3441281
Other catalog numbers recordID:1297475;ProcessID:PBSLI042-09;sampleID:QM JH-0042
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Karus, A.
Reproductive condition sexual
Sex female
Life stage adult
License CC-BY-Int
Field number JH-0042
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Paul Brock

Event

Field number JH-0042
Record date 1969-12-31
Date precision Day

Taxonomy

Scientific name Phasmatodea
Taxon rank order
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Phasmatodea
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Queensland

Additional properties

genbank accession HM425700
markercode COI-5P
nucleotides AACATTATACTTTTTATTAGGAATATGATCAGGAATAATTGGGCTATCAATAAGAATATTAATTCGAATAGAATTAGGTAGACCAGGATCAATTATTGGAAATGATCAAATTTATAATACAATTGTGACAGCCCATGCATTTGTAATGATTTTTTTTATAGTTATACCAATCATAATTGGAGGGTTCGGTAATTGATTACTACCAATTATAATTGGAGCTCCAGATATAGCATTCCCACGTATAAATAATATAAGATTTTGACTATTACCACCATCATTAACATTATTAATTATAAGAAGAATAGTAGATACAGGTACAGGTACAGGGTGGACTCTTTATCCACCTTTAGCGGGACTAACAGGACATAGAAGAATATCTGTAGATTTAACAATTTTTTCACTACATATAGCAGGAATTTCATCAATTCTAGGTGCAGTAAATTTTATTTCAACAACCATTAATATAAAATCACCAGGTATATCAATAGAACAAGTACCCTTATTCGTATGATCAGTAATTATTACAGCAGTATTATTACTACTATCACTACCAGTATTAGCAGGAGCAATTACAATACTATTAACAGACCGAAATATAAATACATCTTTTTTTGATCCATCAGGGGGTGGGGATCCTATTTTATATCAACATTTATTT
Owner institution code Queensland Museum
sequence last updated 2011-11-14T08:11:48Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Coordinates dont match supplied state Passed
    Show/Hide 14 missing properties
    Show/Hide 56 tests that have not been run