Occurrence record:

EnvironmentalDNA of Rhinocladiella recorded on 2014-10-17

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07483695
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2014-10-17
Date precision Day

Taxonomy

Scientific name Rhinocladiella
Taxon rank genus
Kingdom Fungi
Phylum Ascomycota
Class Eurotiomycetes
Order Chaetothyriales
Family Herpotrichiellaceae
Genus Rhinocladiella
Species Rhinocladiella
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Tasmania
Locality Clarence (C)
Locality unifarm 1_shelterbelt
Latitude -42.8072
Longitude 147.43977
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

ammonium nitrogen mg kg 7.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 0.45
clay 12.12
color LTGR
conductivity dsm ds m 0.206
course sand 40.99
depth m 0.0
dtpa copper mg kg 0.78
dtpa iron mg kg 428.88
dtpa manganese mg kg 15.06
dtpa zinc mg kg 3.22
environment Soil
exc aluminium meq 100g 0.289
exc calcium meq 100g 3.93
exc magnesium meq 100g 2.21
exc potassium meq 100g 0.37
exc sodium meq 100g 0.78
fine sand 30.6
gravel 0.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07483695
nitrate nitrogen mg kg 1.0
otu CCGAGTTAGGGTCCTCTGGGCCCGACCTCCTACCCTTTGTCTACCTTACCTCTTGTTGCTTCGGCGGATCCGTCCCTCAAAGGGACCGCCGGGGAGCTCTGAAAAGCTCTCTGGCCCGCGTCCGTCGATGGCCTACAATTCAAACTCTTGCTTAAACGTGTCATCTGAGTCTTAAAAAACCAAAATAATTAA
otucount 3
organic carbon 2.44
ph level cacl2 cacl2 4.3
ph level h2o h2o 5.1
phosphorus colwell mg kg 22.0
potassium colwell mg kg 163.0
sample id 102.100.100/15959
sample type Soil
sand 71.59
silt 16.29
soil moisture 5.82474226804121
sulphur mg kg 8.9
texture 1.5
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Habitat incorrect for species Failed
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Tasmanian Temperate Rainforests
    Important Bird Areas (IBA) Australia South-east Tasmania IBA
    Irrigation practice - dominant 6. Local knowledge
    Land use Irrigated horticulture
    NRM Regions 2010 South
    NRM Regions 2014 South
    NRM Regions 2015 South
    NRM Regions 2017 South NRM Region
    NRM Regions 2017 (Qld 2019) South NRM Region
    Stubble practice - dominant (area) Stubble removed
    Stubble practice - dominant (number) Stubble removed
    Tillage practice - dominant (area) Other cultivation
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 South NRM Region
    Biodiversity
    Freshwater Ecoregions of the World Southern Tasmania
    IBRA 6 Regions Tasmanian South East
    IBRA 6 Sub Regions South East
    IBRA 7 Regions Tasmanian South East
    IBRA 7 Subregions South East
    Terrestrial Ecoregional Boundaries Tasmanian Temperate Forests
    World Anthropogenic Biomes (2000) Residential rainfed croplands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (mild summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 Tasmania
    Drainage Divisions Level 2 COAL RIVER
    River Regions COAL RIVER
    Marine
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Franklin
    Local Government Areas 2011 Clarence (C)
    Local Government Areas 2012 deprecated Clarence
    Local Government Areas PSMA 2018 CLARENCE CITY COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 29
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 6437
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER HOBART
    PSMA ABS SA2 Statistical Areas (2016) CAMBRIDGE
    PSMA ABS SA3 Statistical Areas (2016) HOBART - NORTH EAST
    PSMA ABS SA4 Statistical Areas (2016) HOBART
    PSMA Commonwealth Electoral Boundaries (2016) FRANKLIN
    PSMA Commonwealth Electoral Boundaries (2018) FRANKLIN
    PSMA Indigenous Areas (2016) GREATER HOBART
    PSMA Indigenous Locations (2016) CLARENCE
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) CAMBRIDGE
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) HOBART
    PSMA State Electoral Boundaries (2016) FRANKLIN
    PSMA State Electoral Boundaries (2018) FRANKLIN
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas Clarence (C)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Central Tasmania Region
    Surface Geology of Australia Jdtm
    Topography
    Physiographic Provinces of Australia Tasmanian Uplands Province
    Physiographic Regions 2011 East Tasmanian Hills
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Annual crops and highly modified pastures
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Eucalypt open forests
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 6731.0 dse
    Dairy numbers 874.0 dse
    Dolomite (acidity) 3.0 t/ha
    Gypsum 0.0 t/ha
    Lime 1.0 t/ha
    Natural resource management expenditure 3022633.0 $
    Natural resource management expenditure - additional 2.0 $/ha
    Nitrogen -1.8730716 t/ha
    Sheep numbers 29325.0 dse
    Area management
    Phosphorus -1.9015137 t/ha
    Potassium -1.7381665 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.7157
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.874
    Endemism 0.0131062735
    Endemism (Non-marine) 0.014603675
    Mammals – Fritz et al 2009 - 0.5 degree 0.4126
    Migratory species (2008) 12.0 frequency
    Occurrence Density 27465.0 frequency
    Shannon Diversity (H) 5.8455315 index
    Species Richness 2067.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 13.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.5174956
    2030A1BMk35M: Aridity index - month max 0.978377
    2030A1BMk35M: Aridity index - month min 0.2118773
    2030A1BMk35M: Evaporation - annual mean 92.57 mm
    2030A1BMk35M: Evaporation - month max 165.12 mm
    2030A1BMk35M: Evaporation - month min 37.44 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.04 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.23 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.02 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 75.25398 %
    2030A1BMk35M: Humidity - month max relative 3pm 83.18176 %
    2030A1BMk35M: Humidity - month min relative 3pm 69.099174 %
    2030A1BMk35M: Precipitation - annual mean 37.628334 mm
    2030A1BMk35M: Precipitation - driest month 27.61 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.2027957
    2030A1BMk35M: Precipitation - max difference between successive months 0.31258062 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.36888954 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 1.0240381
    2030A1BMk35M: Precipitation - spring or autumn season 0.2007621
    2030A1BMk35M: Precipitation - summer or winter season 0.023831965
    2030A1BMk35M: Precipitation - wettest month 46.34 mm
    2030A1BMk35M: Precipitation deficit - annual mean -54.941666 mm
    2030A1BMk35M: Precipitation deficit - month max -121.619995 mm
    2030A1BMk35M: Precipitation deficit - month min -0.80999756 mm
    2030A1BMk35M: Radiation - max month precipitation modified 23.26 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 14.140833 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 5.16 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 18.4675 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.513333 degrees C
    2030A1BMk35M: Temperature - annual range 18.970001 degrees C
    2030A1BMk35M: Temperature - coldest month min 4.54 degrees C
    2030A1BMk35M: Temperature - coolest month max 13.26 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.0599976 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.7200012 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 11.130005 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.95417 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.7900085 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.1099854 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 8.519989 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 23.51 degrees C
    2030A1BMk35M: Temperature - warmest month min 12.38 degrees C
    Aridity index - annual mean 0.7366643
    Aridity index - month max 1.6923668
    Aridity index - month min 0.27122217
    Evaporation - annual mean 84.597664 (ml/5km x 5km pixel)
    Evaporation - average 11302.0 ml
    Evaporation - month max 156.73463 mm
    Evaporation - month min 24.817314 mm
    Evaporation - variability 8.0 %
    Growth index C3 macrotherm plants - annual mean 0.02 index
    Growth index C3 mesotherm plants - annual mean 0.23 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 81.388176 %
    Humidity - annual mean relative 3pm 74.59004 %
    Humidity - month max relative 89.078285 %
    Humidity - month max relative 3pm 82.55756 %
    Humidity - month min relative 68.409035 %
    Humidity - month min relative 3pm 68.409035 %
    Precipitation - annual 534.0 mm
    Precipitation - annual (Bio12) 482.0 mm
    Precipitation - annual (log) seasonality index 0.015698466
    Precipitation - annual mean 44.837303 mm
    Precipitation - annual seasonality 0.09110261
    Precipitation - annual seasonality ratio 1.0914568
    Precipitation - autumn 125.0 mm
    Precipitation - autumn reliability 56.0 %
    Precipitation - coldest quarter (Bio19) 117.0 mm
    Precipitation - driest month 38.50991 mm
    Precipitation - driest period (Bio14) 6.0 mm
    Precipitation - driest quarter (Bio17) 97.0 mm
    Precipitation - equinox seasonality ratio 1.1190096
    Precipitation - max difference between successive months 0.47621205 mm/day
    Precipitation - min difference between successive months -0.48387095 mm/day
    Precipitation - seasonality (Bio15) 16.0 mm
    Precipitation - solstice seasonality ratio 1.0654508
    Precipitation - spring 138.0 mm
    Precipitation - spring or autumn (log) season 0.022996856
    Precipitation - spring or autumn season 0.11808116
    Precipitation - spring reliability 70.0 %
    Precipitation - summer 137.0 mm
    Precipitation - summer or winter (log) season 0.012907597
    Precipitation - summer or winter season 0.06495126
    Precipitation - summer reliability 51.0 %
    Precipitation - warmest quarter (Bio18) 123.0 mm
    Precipitation - wettest month 57.50991 mm
    Precipitation - wettest period (Bio13) 12.0 mm
    Precipitation - wettest quarter (Bio16) 142.0 mm
    Precipitation - winter 128.0 mm
    Precipitation - winter reliability 70.0 %
    Precipitation deficit - annual mean -39.760357 mm
    Precipitation deficit - month max -114.224724 mm
    Precipitation deficit - month min 17.182686 mm
    Radiation - annual mean (Bio20) 14.0 MJ/m2/day
    Radiation - coldest quarter (Bio27) 6.4 MJ/m2/day
    Radiation - driest quarter (Bio25) 6.1 MJ/m2/day
    Radiation - highest period (Bio21) 23.6 MJ/m2/day
    Radiation - lowest period (Bio22) 4.9 MJ/m2/day
    Radiation - max month precipitation modified 23.349009 MJ/m2/day
    Radiation - mean annual precipitation modified 13.88935 MJ/m2/day
    Radiation - min month precipitation modified 5.0 MJ/m2/day
    Radiation - seasonality (Bio23) 47.0
    Radiation - warmest quarter (Bio26) 21.0 MJ/m2/day
    Radiation - wettest quarter (Bio24) 21.3 MJ/m2/day
    Temperature - annual max mean 16.625834 degrees C
    Temperature - annual mean (Bio01) 12.6 degrees C
    Temperature - annual min mean 6.9333334 degrees C
    Temperature - annual range 19.06659 degrees C
    Temperature - annual range (Bio07) 19.2 degrees C
    Temperature - coldest month min 2.99 degrees C
    Temperature - coldest period min (Bio06) 3.7 degrees C
    Temperature - coldest quarter mean (Bio11) 8.6 degrees C
    Temperature - coolest month max 11.6 degrees C
    Temperature - diurnal range mean (Bio02) 9.9 degrees C
    Temperature - driest quarter mean (Bio09) 9.5 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - max absolute mean max 39.0 degrees C
    Temperature - max difference in max 1.9299927 degrees C/day
    Temperature - max difference in min 1.6499939 degrees C/day
    Temperature - max month diurnal range 10.869995 degrees C
    Temperature - mean annual absolute mean min -0.7095661 degrees C
    Temperature - mean annual diurnal range 9.692497 degrees C
    Temperature - min absolute mean min -4.663097 degrees C
    Temperature - min difference in max -2.9500122 degrees C/day
    Temperature - min difference in min -2.0599976 degrees C/day
    Temperature - min month diurnal range 8.389984 degrees C
    Temperature - month hottest maximum 21.57 degrees C
    Temperature - month mean absolute max 32.28567 degrees C
    Temperature - seasonality (Bio04) 1.1
    Temperature - warmest month min 10.82 degrees C
    Temperature - warmest period max (Bio05) 22.8 degrees C
    Temperature - warmest quarter (Bio10) 16.6 degrees C
    Temperature - wettest quarter mean (Bio08) 14.8 degrees C
    Vapour pressure deficit - annual mean 0.1594896 KPa
    Vapour pressure deficit - annual mean 9am 0.29835716 KPa
    Vapour pressure deficit - month max 0.47978854 KPa
    Vapour pressure deficit - month max 9am 0.47978854 KPa
    Vapour pressure deficit - month min 0.0018084049 KPa
    Vapour pressure deficit - month min 9am 0.16989642 KPa
    Wind run - annual mean 142.40273 km/day
    Wind run - month max 176.0 km/day
    Wind run - month min 115.50551 km/day
    Wind speed - annual mean 3pm 3.1416667 m/s
    Wind speed - annual mean 9am 2.0583334 m/s
    Wind speed - annual mean 9am or 3pm 3.4 m/s
    Wind speed - month max 3pm 3.9 m/s
    Wind speed - month max 9am 2.9 m/s
    Wind speed - month max 9am or 3pm 3.9 m/s
    Wind speed - month min 3pm 2.4 m/s
    Wind speed - month min 9am 1.4 m/s
    Wind speed - month min 9am or 3pm 1.4 m/s
    WorldClim: Precipitation - annual 540.0 mm
    WorldClim: Precipitation - coldest quarter 136.0 mm
    WorldClim: Precipitation - driest month 35.0 mm
    WorldClim: Precipitation - driest quarter 119.0 mm
    WorldClim: Precipitation - seasonality 13.0
    WorldClim: Precipitation - warmest quarter 119.0 mm
    WorldClim: Precipitation - wettest month 55.0 mm
    WorldClim: Precipitation - wettest quarter 156.0 mm
    WorldClim: Temperature - annual mean 125.0 degrees C * 10
    WorldClim: Temperature - annual range 184.0 degrees C * 10
    WorldClim: Temperature - coldest month min 39.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 83.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 95.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 163.0 degrees C * 10
    WorldClim: Temperature - isothermality 51.0 %
    WorldClim: Temperature - seasonality 3098.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 223.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 163.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 137.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.03 km x 100
    Distance - to non-permanent water (weighted) 0.20124611 degrees
    Distance - to permanent water (weighted) 0.0 km
    Euclidean Distance to Coast (metres) 1458.179 m
    Remoteness index 2.3958044
    Hydrology
    Drainage - average 945.0 megalitres/5x5km/year
    Drainage - variability 136.0 %
    Runoff - average 172.0 megalitres/5x5km/year
    Water Observations From Space 5.4945054 Percentage
    Social
    Disadvantaged 817.66693 points (mean=1000)
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.5004785
    2030A1BMk35M: Crop factor - month max 0.85262674
    2030A1BMk35M: Crop factor - month min 0.2118773
    2030A1BMk35M: Water deficit - month max 84.18119 mm
    2030A1BMk35M: Water deficit - month mean 31.363207 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.3423946 MPa
    2030A1BMk35M: Water potential - month max -0.6942641 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 45.043064
    2030A1BMk35M: Water stress index - month max 76.7364
    2030A1BMk35M: Water stress index - month min 19.068956
    2030A1BMk35M: Water surplus - annual mean 0.0 mm
    2030A1BMk35M: Water surplus - month max 0.0 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 82.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.15 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 30.0 %
    Bouguer gravity anomalies 100.6855 Gal
    Bulk density 1.5842391 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 1.5625666 %
    Carbon store pre-European 153.8555 kgC/ha
    Clay % 44.491848 %
    Crop factor - annual mean 0.63996625
    Crop factor - month max 0.9
    Crop factor - month min 0.27122217
    Erodibility 33.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 712.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 11.1 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 65.5 my
    Lithology - fertility 10.0 index
    Lithology - mean age 32.75 my
    Lithology - mean age (log) 1.5152113 log my
    Lithology - mean age range (log) 1.8162413 log my
    Magnetic anomalies 70.0 nT
    Moisture - average 49.0 %
    Moisture - variability 5.0 %
    Moisture Index - annual mean (Bio28) 0.55
    Moisture Index - coldest quarter mean (Bio35) 0.75
    Moisture Index - highest period (Bio29) 0.87
    Moisture Index - highest quarter mean (Bio32) 0.83
    Moisture Index - lowest period (Bio30) 0.23
    Moisture Index - lowest quarter mean (Bio33) 0.29
    Moisture Index - seasonality (Bio31) 38.0
    Moisture Index - warmest quarter mean (Bio34) 0.3
    Nitrogen - plant-available pre-European 13241.24 kgN/ha
    Nitrogen concentration pre-European 65.06708 mgN kg/H2O
    Nitrogen store pre-European 92.94328 kgN/ha
    Nutrient status 1.15 index
    Pedality hydrological score 3.5451088
    Ph - soil 5.0 ph
    Phosphorus - plant-available pre-European 17.12802 kgP/ha
    Phosphorus - plant-available total pre-European 1492.7634 kgP/ha
    Phosphorus pre-European 11.99086 mgP kg/H2O
    Soil depth 1.0 m
    Soil pedality 3.5451088
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 8.016747
    Unreliable water retention parameters 59.5
    Water deficit - month max 77.677864 mm
    Water deficit - month mean 23.604326 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 40000.0 mm
    Water holding capacity - plant-available 85.0 mm
    Water potential - annual mean -1.0269982 MPa
    Water potential - month max -0.11712641 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 57.596962
    Water stress index - month max 81.0
    Water stress index - month min 24.409996
    Water surplus - annual mean 0.0 mm
    Water surplus - month max 0.0 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 3.85221 Weathering Intensity Index
    Topography
    Aspect 71.0 degrees
    Averaged Topographic Relief 289.66666 metres
    Bathymetry and Topography 9 sec 38.0 m
    Elevation 5.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 1.5233192 degrees
    Topographic relief 27.44879 m
    Topographic roughness 24.05729 %
    Topographic slope (%) 2.383031 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2847 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 13.0 %
    Fractional Cover - Bare Soil (2012-03-05) 15.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 42.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 43.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0147 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.2 m^2 plant / m^2 ground
    NDVI Mean 54.0 NDVI x 100
    NPP Mean 4.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.5312 NDVI
    Phenology peak day of year 2002 dry 249.0 Day
    Phenology peak day of year 2012 wet 276.55554 Day