Occurrence record: BOLD - Australian records - 3496429

GenomicDNA of Plocamiales recorded on 2010-01-27

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3496429
Other catalog numbers recordID:1367417;ProcessID:ABMMC8036-10;sampleID:GWS016159
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Saunders, G.W.|Dixon, K.|Kraft, L.
Supplied as "G.W. Saunders, K. Dixon & L. Kraft"
License CC-BY-Int
Field number GWS016159
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Gerald T. Kraft

Event

Field number GWS016159
Record date 2010-01-27
Date precision Day

Taxonomy

Scientific name Plocamiales
Taxon rank order
Kingdom Plantae
Phylum Rhodophyta
Class Florideophyceae
Order Plocamiales
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Tasmania
Locality Waratah/Wynyard (M)
Locality Boat Harbour Beach
Latitude -40.926
Longitude 145.613
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM918077
markercode COI-5P
nucleotides TACTCTTTATTTAATTTTTGGGGCTTTTTCTGGTATTATTGGAGGTTGTATTTCTATGTTAATTCGTATAGAATTGGCTCAACCAGGTAATCATTTCTTATTAGGAAATCATCAAGTATATAATGTATTAATTACTGCACATGCATTTTTGATGATATTTTTTATGGTAATGCCTGTTATGATAGGTGGTTTTGGTAATTGATTAGTACCTATAATGATTGGAAGTCCAGATATGGCATTTCCTCGATTAAATAATATATCATTTTGATTATTACCACCATCATTATGTTTATTAATAGCATCTGCTATTGTAGAAGTTGGAGTGGGTACAGGTTGAACAGTGTATCCTCCTTTAAGTTCTATACAAAGCCATTCTGGAGGTGCCGTAGATTTAGCTATATTTAGCTTACATTTATCAGGAGCATCATCAATATTAGGAGCTATAAATTTTATATCTACGATATTTAATATGCGTAATTCTGGACAAAGTATGTATAGAATGCCGCTATTCGTTTGATCTATATTAGTTACAGCCTTTTTATTATTATTAGCGGTACCTGTATTAGCTGGAGCTATAACAATGTTGTTAACTGATAGGAATTTTAATACATCATTTTTTGATCCGTCAGGAGGAGGAGATCCTATATTATATCAACATTTATTT
Owner institution code University of New Brunswick, Fredericton
sequence last updated 2011-11-14T08:11:41Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Tasmanian Temperate Rainforests
    Irrigation practice - dominant 6. Local knowledge
    NRM Regions 2010 North West
    NRM Regions 2014 North West TAS
    NRM Regions 2015 North West
    NRM Regions 2017 North West NRM Region
    NRM Regions 2017 (Qld 2019) North West NRM Region
    Stubble practice - dominant (area) Stubble mulched
    Stubble practice - dominant (number) Stubble mulched
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) Other cultivation
    Area management
    National Landcare Program Management Units 2018 North West NRM Region
    Biodiversity
    Freshwater Ecoregions of the World Bass Strait Drainages
    IBRA 6 Regions King
    IBRA 6 Sub Regions King
    IBRA 7 Regions King
    IBRA 7 Subregions King
    Terrestrial Ecoregional Boundaries Tasmanian Temperate Forests
    World Anthropogenic Biomes (2000) Populated rangelands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Marine
    Global Seagrass Species Richness (2003) 4.00000000
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Braddon
    Local Government Areas 2011 Waratah/Wynyard (M)
    Local Government Areas 2012 deprecated Waratah/Wynyard - Pt A
    Local Government Areas PSMA 2018 WARATAH-WYNYARD COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3932
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF TAS.
    PSMA ABS SA2 Statistical Areas (2016) WARATAH
    PSMA ABS SA3 Statistical Areas (2016) WEST COAST
    PSMA ABS SA4 Statistical Areas (2016) WEST AND NORTH WEST
    PSMA Commonwealth Electoral Boundaries (2016) BRADDON
    PSMA Commonwealth Electoral Boundaries (2018) BRADDON
    PSMA Indigenous Areas (2016) TASMANIA - WEST COAST
    PSMA Indigenous Locations (2016) WARATAH
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) BOAT HARBOUR BEACH
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (TAS.)
    PSMA State Electoral Boundaries (2016) MURCHISON
    PSMA State Electoral Boundaries (2018) MURCHISON
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas Waratah/Wynyard (M) - Pt A
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Rocky Cape Region
    Surface Geology of Australia Msr
    Topography
    Physiographic Provinces of Australia Tasmanian Uplands Province
    Physiographic Regions 2011 North West Ramp
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    NVIS 4.1 Major Vegetation Groups Eucalypt Open Forests
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus open forests with a shrubby understorey
    Tenure of Australia's forests (2013) v2.0 Private Freehold

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.5103
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.2931
    Endemism 0.011218561
    Endemism (Non-marine) 0.012797115
    Mammals – Fritz et al 2009 - 0.5 degree 0.4126
    Occurrence Density 5490.0 frequency
    Shannon Diversity (H) 5.7890477 index
    Species Richness 1074.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 1.2955444
    2030A1BMk35M: Aridity index - month max 3.0112128
    2030A1BMk35M: Aridity index - month min 0.2848422
    2030A1BMk35M: Evaporation - annual mean 90.033005 mm
    2030A1BMk35M: Evaporation - month max 156.56572 mm
    2030A1BMk35M: Evaporation - month min 44.464287 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.047857143 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.37142858 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.03 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 82.92138 %
    2030A1BMk35M: Humidity - month max relative 3pm 88.78334 %
    2030A1BMk35M: Humidity - month min relative 3pm 76.243866 %
    2030A1BMk35M: Precipitation - annual mean 84.12572 mm
    2030A1BMk35M: Precipitation - driest month 37.12857 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.1171012
    2030A1BMk35M: Precipitation - max difference between successive months 0.9312988 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.7041519 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 0.40347895
    2030A1BMk35M: Precipitation - spring or autumn season 0.11659838
    2030A1BMk35M: Precipitation - summer or winter season -1.468593
    2030A1BMk35M: Precipitation - wettest month 133.89143 mm
    2030A1BMk35M: Precipitation deficit - annual mean -5.907294 mm
    2030A1BMk35M: Precipitation deficit - month max -102.77501 mm
    2030A1BMk35M: Precipitation deficit - month min 89.42715 mm
    2030A1BMk35M: Radiation - max month precipitation modified 23.152857 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 13.514584 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 4.5278573 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 17.079346 degrees C
    2030A1BMk35M: Temperature - annual min mean 8.796488 degrees C
    2030A1BMk35M: Temperature - annual range 16.369263 degrees C
    2030A1BMk35M: Temperature - coldest month min 5.470714 degrees C
    2030A1BMk35M: Temperature - coolest month max 12.601429 degrees C
    2030A1BMk35M: Temperature - max difference in max 1.9492798 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 1.7414246 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 9.248566 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 8.28286 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.536438 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -1.8971558 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 7.0864563 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 21.84 degrees C
    2030A1BMk35M: Temperature - warmest month min 12.637143 degrees C
    Precipitation - annual (Bio12) 1078.0 mm
    Precipitation - coldest quarter (Bio19) 384.16666 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 153.16667 mm
    Precipitation - seasonality (Bio15) 33.5 mm
    Precipitation - warmest quarter (Bio18) 153.16667 mm
    Precipitation - wettest period (Bio13) 34.833332 mm
    Precipitation - wettest quarter (Bio16) 384.16666 mm
    Precipitation deficit - annual mean 10.9854355 mm
    Precipitation deficit - month max -108.71852 mm
    Radiation - annual mean (Bio20) 13.333333 MJ/m2/day
    Radiation - coldest quarter (Bio27) 5.95 MJ/m2/day
    Radiation - driest quarter (Bio25) 20.349998 MJ/m2/day
    Radiation - highest period (Bio21) 23.45 MJ/m2/day
    Radiation - lowest period (Bio22) 4.3 MJ/m2/day
    Radiation - seasonality (Bio23) 52.0
    Radiation - warmest quarter (Bio26) 20.349998 MJ/m2/day
    Radiation - wettest quarter (Bio24) 5.95 MJ/m2/day
    Temperature - annual mean (Bio01) 12.166667 degrees C
    Temperature - annual range (Bio07) 16.433334 degrees C
    Temperature - coldest period min (Bio06) 4.616667 degrees C
    Temperature - coldest quarter mean (Bio11) 8.716667 degrees C
    Temperature - diurnal range mean (Bio02) 8.216667 degrees C
    Temperature - driest quarter mean (Bio09) 15.866667 degrees C
    Temperature - isothermality (Bio03) 0.49833333 %
    Temperature - seasonality (Bio04) 0.98
    Temperature - warmest period max (Bio05) 21.05 degrees C
    Temperature - warmest quarter (Bio10) 15.866667 degrees C
    Temperature - wettest quarter mean (Bio08) 8.716667 degrees C
    Wind run - annual mean 162.48698 km/day
    Wind run - month max 186.36696 km/day
    Wind run - month min 141.49242 km/day
    Wind speed - annual mean 3pm 3.45 m/s
    Wind speed - annual mean 9am 2.375 m/s
    Wind speed - annual mean 9am or 3pm 3.6 m/s
    Wind speed - month max 3pm 4.1 m/s
    Wind speed - month max 9am 3.1 m/s
    Wind speed - month max 9am or 3pm 4.1 m/s
    Wind speed - month min 3pm 2.7 m/s
    Wind speed - month min 9am 1.9 m/s
    Wind speed - month min 9am or 3pm 1.9 m/s
    WorldClim: Precipitation - annual 1031.0 mm
    WorldClim: Precipitation - coldest quarter 359.0 mm
    WorldClim: Precipitation - driest month 43.0 mm
    WorldClim: Precipitation - driest quarter 146.0 mm
    WorldClim: Precipitation - seasonality 33.0
    WorldClim: Precipitation - warmest quarter 146.0 mm
    WorldClim: Precipitation - wettest month 136.0 mm
    WorldClim: Precipitation - wettest quarter 359.0 mm
    WorldClim: Temperature - annual mean 127.0 degrees C * 10
    WorldClim: Temperature - annual range 165.0 degrees C * 10
    WorldClim: Temperature - coldest month min 50.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 91.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 83.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 164.0 degrees C * 10
    WorldClim: Temperature - isothermality 50.0 %
    WorldClim: Temperature - seasonality 2798.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 215.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 164.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 91.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.089999996 degrees
    Distance - to coast 0.01 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.09899495 km
    Euclidean Distance to Coast (metres) 1688.8912 m
    Hydrology
    Water Observations From Space 0.6896552 Percentage
    Marine
    GEOMACS - geometric mean 0.00778 Pascals
    Sea Surface Temperature - MODIS Terra 14.671384 Degrees C
    SeaWIFS K490 Mean 0.09844331 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.8420703 mg/m^3
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.7914656
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.31096706
    2030A1BMk35M: Water deficit - month max 21.993378 mm
    2030A1BMk35M: Water deficit - month mean 2.406123 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.48989272 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 71.231895
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 27.987036
    2030A1BMk35M: Water surplus - annual mean 15.037927 mm
    2030A1BMk35M: Water surplus - month max 72.27356 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    Bouguer gravity anomalies 63.21526 Gal
    Bulk density 1.2022984 Mg/m^3
    Calcrete 0.0 presence
    Carbon store pre-European 135.08435 kgC/ha
    Clay % 54.002018 %
    Erosional surfaces - proportion 50.0 %
    Hydrologic conductivity - average saturated 130.76923 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 462.5 my
    Lithology - fertility 8.0 index
    Lithology - mean age 433.85 my
    Lithology - mean age (log) 2.115187 log my
    Lithology - mean age range (log) 2.299539 log my
    Magnetic anomalies -1.0 nT
    Moisture Index - annual mean (Bio28) 0.80833334
    Moisture Index - coldest quarter mean (Bio35) 1.0
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.29166666
    Moisture Index - lowest quarter mean (Bio33) 0.40333334
    Moisture Index - seasonality (Bio31) 31.5
    Moisture Index - warmest quarter mean (Bio34) 0.435
    Nitrogen - plant-available pre-European 11418.158 kgN/ha
    Nitrogen concentration pre-European 52.926758 mgN kg/H2O
    Nitrogen store pre-European 154.67694 kgN/ha
    Nutrient status 2.1 index
    Pedality hydrological score 3.7705646
    Phosphorus - plant-available pre-European 28.39081 kgP/ha
    Phosphorus - plant-available total pre-European 1576.6005 kgP/ha
    Phosphorus pre-European 9.714388 mgP kg/H2O
    Soil depth 1.14 m
    Soil pedality 3.7705646
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 2.884488
    Unreliable water retention parameters 0.0
    Water holding capacity - plant-available 190.0 mm
    Weathering Intensity V2 2.98584 Weathering Intensity Index
    Topography
    Averaged Topographic Relief 213.70833 metres
    Bathymetry and Topography 9 sec -1.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Topographic Slope (degrees) 0.9924322 degrees
    Topographic relief 39.40375 m
    Topographic roughness 59.53869 %
    Topographic slope (%) 6.297751 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1589 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 89.0 %
    Gross Primary Productivity (2012-03-13) 0.0617 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 5.6 m^2 plant / m^2 ground
    Normalized Difference Vegetation Index (2012-03-05) 0.4705 NDVI
    Phenology peak day of year 2002 dry 227.06451 Day
    Phenology peak day of year 2012 wet 142.41936 Day