Occurrence record: BOLD - Australian records - 3496429

Material Sample of Plocamiales recorded on 2010-01-27

API

Dataset

Data partner	Barcode of Life
Data resource	BOLD - Australian records
Catalog number	3496429
Other catalog numbers	["recordID:1367417;ProcessID:ABMMC8036-10;sampleID:GWS016159"]
Record type	Material Sample Supplied basis "MaterialSample"
Preparations	nullnull
Collector	1. Saunders, G.W. 2. Dixon, K. 3. Kraft, L. Supplied as "G.W. Saunders, K. Dixon & L. Kraft"
License	CC-BY-Int
Presence/Absence	PRESENT
Identification ID	Gerald T. Kraft

Event

Field Number	GWS016159
Occurrence date	2010-01-27
Date precision	DAY

Taxonomy

Scientific name	Plocamiales
Identified to rank	order
Kingdom	Plantae
Phylum	Rhodophyta
Class	Florideophyceae
Order	Plocamiales
Name match metric	exactMatch
Name parse type	SCIENTIFIC

Geospatial

Country	Australia
State or Territory	Tasmania
Locality	Boat Harbour Beach
Latitude	-40.926 Supplied as: "-40.926"
Longitude	145.613 Supplied as: "145.613"
Datum	EPSG:4326
Coordinate precision	Unknown
Terrestrial	true
Biome	TERRESTRIAL
Marine	false
Country Code	AU

Additional properties

genbank accession	HM918077
markercode	COI-5P
nucleotides	TACTCTTTATTTAATTTTTGGGGCTTTTTCTGGTATTATTGGAGGTTGTATTTCTATGTTAATTCGTATAGAATTGGCTCAACCAGGTAATCATTTCTTATTAGGAAATCATCAAGTATATAATGTATTAATTACTGCACATGCATTTTTGATGATATTTTTTATGGTAATGCCTGTTATGATAGGTGGTTTTGGTAATTGATTAGTACCTATAATGATTGGAAGTCCAGATATGGCATTTCCTCGATTAAATAATATATCATTTTGATTATTACCACCATCATTATGTTTATTAATAGCATCTGCTATTGTAGAAGTTGGAGTGGGTACAGGTTGAACAGTGTATCCTCCTTTAAGTTCTATACAAAGCCATTCTGGAGGTGCCGTAGATTTAGCTATATTTAGCTTACATTTATCAGGAGCATCATCAATATTAGGAGCTATAAATTTTATATCTACGATATTTAATATGCGTAATTCTGGACAAAGTATGTATAGAATGCCGCTATTCGTTTGATCTATATTAGTTACAGCCTTTTTATTATTATTAGCGGTACCTGTATTAGCTGGAGCTATAACAATGTTGTTAACTGATAGGAATTTTAATACATCATTTTTTGATCCGTCAGGAGGAGGAGATCCTATATTATATCAACATTTATTT
Owner institution code	University of New Brunswick, Fredericton
sequence last updated	2011-11-14T08:11:41Z

User flagged issues

Data quality tests

Test name	Result
Coordinate uncertainty meters invalid	Warning
First of the year	Warning
Geodetic datum assumed WGS84	Warning
Name not supplied	Warning
Show/Hide 79 passed properties
Basis of record badly formed	Passed
CONTINENT_COORDINATE_MISMATCH	Passed
Continent country mismatch	Passed
Continent derived from coordinates	Passed
CONTINENT_DERIVED_FROM_COUNTRY	Passed
Continent invalid	Passed
Coordinates centre of country	Passed
Supplied coordinates centre of state	Passed
Coordinate invalid	Passed
Coordinates are out of range for species	Passed
Coordinates converted to WGS84	Passed
Decimal latitude/longitude conversion failed	Passed
Coordinate reprojection suspicious	Passed
Coordinate rounded	Passed
Coordinates dont match supplied country	Passed
Country inferred from coordinates	Passed
Country invalid	Passed
Country mismatch	Passed
First of the century	Passed
First of the month	Passed
Unrecognized geodetic datum	Passed
Georeferenced after occurrence date	Passed
Identification date before occurrence date	Passed
Interpretation error	Passed
Invalid scientific name	Passed
Location not supplied	Passed
Missing collection date	Passed
Modified date invalid	Passed
Modified date unlikely	Passed
Multimedia date invalid	Passed
Multimedia uri invalid	Passed
Occurrence status inferred from basis of record	Passed
Occurrence status inferred from individual count	Passed
Occurrence status unparsable	Passed
Latitude is negated	Passed
Longitude is negated	Passed
Presumed swapped coordinate	Passed
Recorded date invalid	Passed
Recorded date mismatch	Passed
Recorded date unlikely	Passed
SCIENTIFIC_NAME_AND_ID_INCONSISTENT	Passed
Sensitivity report invalid	Passed
Sensitivity report not loadable	Passed
Coordinates dont match supplied state	Passed
Taxon affinity species	Passed
TAXON_CONCEPT_ID_NOT_FOUND	Passed
Taxon confer species	Passed
Taxon default match	Passed
Taxon error	Passed
Taxon excluded	Passed
Taxon excluded associated	Passed
Taxon homonym	Passed
Taxon indeterminate species	Passed
Taxon match aggregate	Passed
Taxon match fuzzy	Passed
Taxon match higher rank	Passed
TAXON_MATCH_NAME_AND_ID_AMBIGUOUS	Passed
Taxon match none	Passed
TAXON_MATCH_TAXON_CONCEPT_ID_IGNORED	Passed
Taxon misapplied	Passed
Taxon misapplied matched	Passed
Taxon parent child synonym	Passed
Taxon question species	Passed
Resource taxonomic scope mismatch	Passed
Taxon species plural	Passed
Coordinate precision and uncertainty transposed	Passed
Uncertainty not specified	Passed
Supplied country not recognised	Passed
Kingdom not recognised	Passed
Supplied coordinates are zero	Passed
Biosecurity issue	Passed
Suspected outlier	Passed
Geospatial issue	Passed
Habitat incorrect for species	Passed
Taxon misidentified	Passed
Taxonomic issue	Passed
Temporal issue	Passed
Other issue	Passed
Duplicate record	Passed
Show/Hide 7 missing properties
Missing geodetic datum	Missing
Missing georeferenced by	Missing
Missing georeference protocol	Missing
Missing georeference sources	Missing
Missing georeference verification status	Missing
Missing georeference date	Missing
Missing taxon rank	Missing
Show/Hide 34 tests that have not been run
Unrecognized collection code	Unchecked (lack of data)
Unrecognized institution code	Unchecked (lack of data)
Coordinate precision invalid	Unchecked (lack of data)
Footprint SRS invalid	Unchecked (lack of data)
Footprint WKT mismatch	Unchecked (lack of data)
Footprint WKT invalid	Unchecked (lack of data)
TAXON_MATCH_SCIENTIFIC_NAME_ID_IGNORED	Unchecked (lack of data)
TAXON_MATCH_TAXON_ID_IGNORED	Unchecked (lack of data)
SCIENTIFIC_NAME_ID_NOT_FOUND	Unchecked (lack of data)
TAXON_ID_NOT_FOUND	Unchecked (lack of data)
Depth value supplied in feet	Unchecked (lack of data)
Depth unlikely	Unchecked (lack of data)
Min and max depth reversed	Unchecked (lack of data)
Depth value non-numeric	Unchecked (lack of data)
Elevation unlikely	Unchecked (lack of data)
Min and max altitude reversed	Unchecked (lack of data)
Altitude value supplied in feet	Unchecked (lack of data)
Altitude value non-numeric	Unchecked (lack of data)
Identified date unlikely	Unchecked (lack of data)
Identified date invalid	Unchecked (lack of data)
Type status invalid	Unchecked (lack of data)
References uri invalid	Unchecked (lack of data)
Individual count invalid	Unchecked (lack of data)
Individual count conflicts with occurrence status	Unchecked (lack of data)
Georeferenced date unlikely	Unchecked (lack of data)
Georeferenced date invalid	Unchecked (lack of data)
Ambiguous institution	Unchecked (lack of data)
Ambiguous collection	Unchecked (lack of data)
Institution not matched	Unchecked (lack of data)
Collection not matched	Unchecked (lack of data)
Institution match fuzzy	Unchecked (lack of data)
Collection match fuzzy	Unchecked (lack of data)
Institution and Collection mismatch	Unchecked (lack of data)
Different owner institution	Unchecked (lack of data)

Additional political boundaries information

Area Management
NRM Regions 2010	North West
NRM Regions 2017	North West NRM Region
Area management
National Landcare Program Management Units 2018	North West NRM Region
Biodiversity
IBRA 6 Regions	King
IBRA 7 Regions	King
IBRA 7 Subregions	King
Marine
States including coastal waters	Tasmania (including Coastal Waters)
Political
ASGS Australian States and Territories	Tasmania
Australian States and Territories	Tasmania
Local Government Areas 2011	Waratah/Wynyard (M)
Local Government Areas 2012 deprecated	Waratah/Wynyard - Pt A
Local Government Areas PSMA 2018	WARATAH-WYNYARD COUNCIL
PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016)	3
PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016)	3932
PSMA ABS Greater Capital City Statistical Areas (2016)	REST OF TAS.
PSMA ABS SA2 Statistical Areas (2016)	WARATAH
PSMA ABS SA3 Statistical Areas (2016)	WEST COAST
PSMA ABS SA4 Statistical Areas (2016)	WEST AND NORTH WEST
PSMA Commonwealth Electoral Boundaries (2018)	BRADDON
PSMA Indigenous Areas (2016)	TASMANIA - WEST COAST
PSMA Indigenous Locations (2016)	WARATAH
PSMA Indigenous Regions (2016)	TASMANIA
PSMA Remoteness Areas (2016)	Outer Regional Australia
PSMA State Electoral Boundaries (2018)	MURCHISON
PSMA States (2016)	TASMANIA
World Country Boundaries	Australia
Vegetation
Australia's Indigenous forest estate (2013) v2.0	Non-Indigenous, Non forest
Forests of Australia (2013) v2.0	Non Forest
Forests of Australia 2018B	Non forest
NVIS 4.1 Major Vegetation Groups	Eucalypt Open Forests
NVIS 4.1 Major Vegetation Subgroups	Eucalyptus open forests with a shrubby understorey
Tenure of Australia's forests (2013) v2.0	Private Freehold

Environmental sampling for this location

Climate
Precipitation - annual (Bio12)	1078.0 mm
Precipitation - coldest quarter (Bio19)	384.16666 mm
Precipitation - driest period (Bio14)	10.0 mm
Precipitation - driest quarter (Bio17)	153.16667 mm
Precipitation - seasonality (Bio15)	33.5 mm
Precipitation - warmest quarter (Bio18)	153.16667 mm
Precipitation - wettest period (Bio13)	34.833332 mm
Precipitation - wettest quarter (Bio16)	384.16666 mm
Radiation - annual mean (Bio20)	13.333333 MJ/m2/day
Radiation - seasonality (Bio23)	52.0
Radiation - warmest quarter (Bio26)	20.349998 MJ/m2/day
Temperature - annual mean (Bio01)	12.166667 degrees C
Temperature - annual range (Bio07)	16.433334 degrees C
Temperature - coldest period min (Bio06)	4.616667 degrees C
Temperature - coldest quarter mean (Bio11)	8.716667 degrees C
Temperature - diurnal range mean (Bio02)	8.216667 degrees C
Temperature - driest quarter mean (Bio09)	15.866667 degrees C
Temperature - isothermality (Bio03)	0.49833333 %
Temperature - seasonality (Bio04)	0.98
Temperature - warmest period max (Bio05)	21.05 degrees C
Temperature - warmest quarter (Bio10)	15.866667 degrees C
Temperature - wettest quarter mean (Bio08)	8.716667 degrees C
WorldClim 2.1: Temperature - annual mean	12.766666 °C
WorldClim: Temperature - isothermality	50.0 %
Substrate
Moisture Index - annual mean (Bio28)	0.80833334
Moisture Index - highest quarter mean (Bio32)	1.0

Group	Field Name	Original Value	Processed Value
Classification	Scientific name		Plocamiales
	Match type		exactMatch
	Phylum id		NZOR-6-121299
	Taxon concept ID		NZOR-6-54089
	Order	Plocamiales	Plocamiales
	Taxon rank id		4000
	Taxon identification issue	[FIRST_OF_YEAR]
	Left		523333
	Taxon rank		order
	Name type		SCIENTIFIC
	Order id		NZOR-6-54089
	Right		523369
	Kingdom		Plantae
	Class id		NZOR-6-126473
	Phylum	Rhodophyta	Rhodophyta
	Class		Florideophyceae
	Kingdom id		https://id.biodiversity.org.au/taxon/apni/51744352
Event	Year		2010
	Month		1
	Date precision		DAY
	Day		27
	Event date	2010-01-27	2010-01-27
Identification	Identification ID	Gerald T. Kraft
Occurrence	Field number	GWS016159
	Type		PhysicalObject
	Catalog number	3496429
	Occurrence status		PRESENT
	Basis of record	MaterialSample	MATERIAL_SAMPLE
	Modified	2011-11-14T08:11:41Z	2011-11-14T08:11:41Z
	Preparations	nullnull
	Recorded by	G.W. Saunders, K. Dixon & L. Kraft	[Saunders, G.W., Dixon, K., Kraft, L.]
	Other catalog numbers	[recordID:1367417;ProcessID:ABMMC8036-10;sampleID:GWS016159]
Attribution	Data resource		BOLD - Australian records
	License		CC-BY-Int
	Data provider uid		dp35
	Provenance		Published dataset
	Data Resource ID	dr375	dr375
	Data partner		Barcode of Life
Location	Country	Australia	Australia
	Decimal latitude	-40.926	-40.926
	Terrestrial	true	true
	Locality	Boat Harbour Beach	Boat Harbour Beach
	Decimal longitude	145.613	145.613
	State province	Tasmania	Tasmania
	Biome		TERRESTRIAL
	Lga	Waratah/Wynyard (M)
	Marine	false	false
	Country code		AU
	Geodetic datum		EPSG:4326