Occurrence record: BOLD - Australian records - 3512391

GenomicDNA of Pantopoda recorded on 2009-11-27

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3512391
Other catalog numbers recordID:1361006;ProcessID:QMPYC813-10;sampleID:SHE008
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Arango, C. Claudia
Supplied as "Claudia Arango"
License CC-BY-Int
Field number SHE008
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Claudia Arango

Event

Field number SHE008
Record date 2009-11-27
Date precision Day

Taxonomy

Scientific name Pantopoda
Taxon rank order
Kingdom Animalia
Phylum Arthropoda
Class Pycnogonida
Order Pantopoda
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province New South Wales
Locality Shellharbour (C)
Latitude -34.593
Longitude 150.9
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession HM381707
markercode COI-5P
nucleotides -ACTTTATATTTAATTTTCGGTTTATGAACAGCAATAATTGGTTTAAGATTGAGAGTTATTATCCGTATTGAATTAGGGTCTCCAAGTGCATTAATTGGTAATGATCAAATTTATAATGTTATTGTCACATCACATGCCTTTGTAATAATTTTTTTTATAGTTATGCCTGTAATGATAGGAGGTTTTGGGAACTGATTATTACCTTTAATAATTGGTGCCCCTGATATAGCATTTCCTCGTTTAAATAACTTTAGATTTTGGATACTTCCTCCTGCTTTAACATTATTAATGCTATCTTCCTCTGTAGAGAGGGGGGCCGGTACAGGATGGACTGTCTATCCTCCTTTATCAGGGAACATTGCACACTCTGGTGTCTCAGTTGATTTAGCAATTTTTTCTCTACATTTAGCTGGTATCTCTTCAATTTTGAGATCTTTAAATTTTATGGTAACATTAAAAAATATACGTCCAAATTCAATAAAATATGAAATAATACCTTTATTTGTTTGAAGGGTATTGATTACAGCTTTCCTGTTGGTTGCTTCTTTACCTGTTTTAGCAGGAGCTATTACCATACTTTTATTAGACCGAAATTTTAATACTTCTTTTTTTGATCCATCAGGAGGAGGAGACCCTATTTTATACCAACATTTATTT
Owner institution code Queensland Museum
sequence last updated 2011-11-14T08:11:50Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Coral Ecoregions South-east Australia
    Fallow practice - dominant (area) No practices
    Fallow practice - dominant (number) No practices
    Irrigation practice - dominant No irrigation
    NRM Regions 2010 Southern Rivers
    NRM Regions 2014 South East NSW
    NRM Regions 2015 South East NSW
    NRM Regions 2017 South East NSW
    NRM Regions 2017 (Qld 2019) South East NSW
    Stubble practice - dominant (area) Removed by hot burn
    Stubble practice - dominant (number) Removed by hot burn
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 South East NSW
    Biodiversity
    IMCRA 4 Regions Southeast Shelf Transition
    IMCRA Meso-scale Bioregions Batemans Shelf
    World Anthropogenic Biomes (2000) Urban
    Climate
    Agroclimatic classification of Australia Warmer and wetter end of the warm, wet sub-tropical climates
    Hydrology
    Drainage Divisions Level 1 South East Coast (NSW)
    Drainage Divisions Level 2 WOLLONGONG COAST
    River Regions WOLLONGONG COAST
    Marine
    FAO Fishery Statistical Areas 81
    Geomorphology of the Australian Margin and adjacent seafloor Shelf
    Global Seagrass Species Richness (2003) 5.00000000
    Marine Ecoregions of the World Cape Howe
    States including coastal waters New South Wales (including Coastal Waters)
    Territorial Sea Territorial Sea
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Gilmore
    Local Government Areas 2011 Shellharbour (C)
    Local Government Areas 2012 deprecated Shellharbour
    Local Government Areas PSMA 2018 SHELLHARBOUR CITY COUNCIL
    NSW Local Land Services Regions South East
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 12
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3015
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) SHELLHARBOUR - FLINDERS
    PSMA ABS SA3 Statistical Areas (2016) KIAMA - SHELLHARBOUR
    PSMA ABS SA4 Statistical Areas (2016) ILLAWARRA
    PSMA Commonwealth Electoral Boundaries (2016) WHITLAM
    PSMA Commonwealth Electoral Boundaries (2018) WHITLAM
    PSMA Indigenous Areas (2016) KIAMA - SHELLHARBOUR
    PSMA Indigenous Locations (2016) SHELLHARBOUR
    PSMA Indigenous Regions (2016) SYDNEY - WOLLONGONG
    PSMA Localities (2018) SHELL COVE
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) MAJOR URBAN
    PSMA Section of State Range (2016) 250,000 TO 999,999
    PSMA Significant Urban Area (2016) WOLLONGONG
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) WOLLONGONG
    Statistical Local Areas Shellharbour (C)
    World Country Boundaries Australia
    Surface Geology of Australia Pagr

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.0798
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.4667
    Endemism 0.031101162
    Endemism (Non-marine) 0.03516314
    Mammals – Fritz et al 2009 - 0.5 degree 0.4792
    Occurrence Density 78638.0 frequency
    Shannon Diversity (H) 5.3394003 index
    Species Richness 2895.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 1661.4457 m
    Marspec Distance to Shore 1.0 km
    Hydrology
    Water Observations From Space 59.677418 Percentage
    Marine
    GEOMACS - geometric mean 0.028935 Pascals
    Marspec Annual Range in Sea Surface Salinity 0.13 100 x psu
    Marspec Annual Range in Sea Surface Temperature 5.77 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 0.16 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 4.322 10,000 x degrees C
    Marspec Bathymetric Slope 0.8 10 x degrees
    Marspec Concavity 0.074 1000 x degrees
    Marspec East/West Aspect 0.88 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.59 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.53 100 x psu
    Marspec Mean Annual Sea Surface Temperature 19.15 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.46 100 x psu
    Marspec North/South Aspect -0.48 1 x radians
    Marspec Plan Curvature 0.0041 x 10000
    Marspec Profile Curvature -0.0033 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 16.26 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 22.029999 100 x degrees C
    Sea Surface Temperature - MODIS Terra 19.23752 Degrees C
    SeaWIFS K490 Mean 0.1221657 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 1.3463336 mg/m^3
    Topography
    Averaged Topographic Relief 104.541664 metres
    Bathymetry and Topography 9 sec 26.0 m
    Topographic Slope (degrees) 0.7146958 degrees
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.0375 EVI
    Normalized Difference Vegetation Index (2012-03-05) 0.0904 NDVI
    Phenology peak day of year 2002 dry 158.71428 Day
    Phenology peak day of year 2012 wet 137.82759 Day