We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3566006

GenomicDNA of LEPIDOPTERA | Moths recorded on 2007-01-22

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3566006
Other catalog numbers recordID:1416879;ProcessID:GWORX123-10;sampleID:BC EF Alc 01045
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number BC EF Alc 01045
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Alc 01045
Occurrence date 2007-01-22
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Western Downs (R)
Locality West Cott
Latitude -26.8642
Longitude 151.568
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM912386
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGTACTTCATTAAGATTACTAATTCGAGCTGAATTAGGAACCCCCGGATCTTTAATTGGAGATGATCAAATTTATAATACCATTGTAACTGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCTATTATAATTGGAGGATTTGGAAATTGACTTGTCCCATTAATATTAGGAGCTCCTGATATAGCTTTTCCACGAATAAATAATATAAGATTTTGACTTTTACCCCCATCATTAACTCTTTTAATTTCAAGAAGAATTGTAGAAAATGGGGCAGGAACAGGATGAACAGTATATCCCCCACTTTCATCTAATATTGCACATGGAGGTAGATCGGTTGATTTAGCTATTTTTTCACTACATTTAGCTGGAATTTCATCAATTTTAGGAGCAATTAATTTTATTTCAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTCATTTGAGCAGTAGGTATTACTGCATTTTTATTACTTTTATCATTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACTGATCGTAATTTAAATACATCATTTTTCGACCCTGCTGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:19Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Bunya Mountains
    CAPAD 2012 Terrestrial Bunya Mountains
    CAPAD 2014 Terrestrial Bunya Mountains
    CAPAD 2016 Terrestrial Bunya Mountains
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia Bunya Mountains & Yarraman IBA
    Irrigation practice - dominant 6. Local knowledge
    Land use Nature conservation
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW21
    Murray-Darling Basin Ground Water Plan Areas (2018) Condamine-Balonne
    Murray-Darling Basin Ground Water SDL Resource Units Upper Condamine Basalts (GS65)
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Upper Condamine Basalts (GS65)
    Murray-Darling Basin Surface Water Plan Areas SW19
    Murray-Darling Basin Surface Water Plan Areas (2019) Condamine-Balonne
    Murray-Darling Basin Surface Water SDL Resource Units SS26
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Condamine���Balonne
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys CONDAMINE
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones slopes
    NRM Regions 2010 Condamine
    NRM Regions 2014 Condamine
    NRM Regions 2015 Condamine
    NRM Regions 2017 Condamine
    NRM Regions 2017 (Qld 2019) Southern Queensland Landscapes
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) Other cultivation
    Tillage practice - dominant (number) Other cultivation
    Area management
    National Landcare Program Management Units 2018 Condamine
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions South Eastern Queensland
    IBRA 6 Sub Regions South Burnett
    IBRA 7 Regions South Eastern Queensland
    IBRA 7 Subregions South Burnett
    Terrestrial Ecoregional Boundaries Eastern Australian Temperate Forests
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Moisture is the main limit on crop growth. Growth index lowest in spring
    Koppen Climate Classification (All Classes) Temperate: no dry season (hot summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Rainforest (tropical)
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions CONDAMINE-CULGOA RIVERS
    Marine
    Marine Ecoregions of the World Tweed-Moreton
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Maranoa
    Indigenous Land Use Agreements Barunggam, Cobble Cobble, Jarowair, Western Wakka Wakka, Yiman and QGC ILUA
    Local Government Areas 2011 Western Downs (R)
    Local Government Areas 2012 deprecated Wambo
    Local Government Areas PSMA 2018 WESTERN DOWNS REGIONAL
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari, Guwamu/Kooma, Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari/Kungarri, Guwamu (Kooma), Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari, Guwamu/Kooma, Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Barunggam, Bidjara, Bigambul, Euahlayi, Gomeroi/Kamilaroi, Giabel, Githabul, Gunggari, Guwamu (Kooma), Jarowair, Kambuwal, Mandandanji, Murrawarri, Wakka Wakka
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1133
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) WAMBO
    PSMA ABS SA3 Statistical Areas (2016) DARLING DOWNS - EAST
    PSMA ABS SA4 Statistical Areas (2016) DARLING DOWNS - MARANOA
    PSMA Commonwealth Electoral Boundaries (2016) MARANOA
    PSMA Commonwealth Electoral Boundaries (2018) MARANOA
    PSMA Indigenous Areas (2016) WESTERN DOWNS
    PSMA Indigenous Locations (2016) WAMBO
    PSMA Indigenous Regions (2016) TOOWOOMBA - ROMA
    PSMA Localities (2018) BUNYA MOUNTAINS
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) CONDAMINE
    PSMA State Electoral Boundaries (2018) CALLIDE
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Western Downs (R) - Wambo
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Clarence-Moreton Region
    Surface Geology of Australia Czbmr
    Topography
    Physiographic Provinces of Australia New England-Moreton Uplands Province
    Physiographic Regions 2011 Toowoomba Plateau
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    IGBP Land Cover vegetation classification scheme (2011) Evergreen broadleaf forest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    NVIS 4.1 Major Vegetation Subgroups Tropical or sub-tropical rainforest
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Modified
    Vegetation types - native Rainforests and vine thickets
    Vegetation types - present Rainforest and vine thickets

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 5251976.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6147
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.0882
    Endemism 0.06363783
    Endemism (Non-marine) 0.06680686
    Mammals – Fritz et al 2009 - 0.5 degree 0.4792
    Migratory species (2008) 6.0 frequency
    Occurrence Density 18488.0 frequency
    Shannon Diversity (H) 5.9126267 index
    Species Richness 2320.0 frequency
    Threatened communities (2008) 2.0 frequency
    Threatened species (2008) 14.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.43531308
    2030A1BMk35M: Evaporation - month min 70.83 mm
    2030A1BMk35M: Precipitation - annual mean 66.645004 mm
    2030A1BMk35M: Precipitation - driest month 22.8 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.9121785
    2030A1BMk35M: Precipitation - spring or autumn season -0.09572578
    2030A1BMk35M: Temperature - annual max mean 23.2975 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.573334 degrees C
    2030A1BMk35M: Temperature - annual range 23.940002 degrees C
    Aridity index - annual mean 0.6875361
    Aridity index - month max 1.1312741
    Aridity index - month min 0.40032366
    Evaporation - annual mean 124.68274 (ml/5km x 5km pixel)
    Evaporation - average 20501.0 ml
    Evaporation - month max 197.20625 mm
    Evaporation - month min 54.982788 mm
    Evaporation - variability 12.0 %
    Growth index C3 macrotherm plants - annual mean 0.16 index
    Growth index C3 mesotherm plants - annual mean 0.4 index
    Growth index C4 megatherm plants - annual mean 0.11 index
    Humidity - annual mean relative 80.13589 %
    Humidity - annual mean relative 3pm 66.10329 %
    Humidity - month max relative 88.54299 %
    Humidity - month max relative 3pm 72.44612 %
    Humidity - month min relative 60.135963 %
    Humidity - month min relative 3pm 60.135963 %
    Precipitation - annual 781.0 mm
    Precipitation - annual (Bio12) 892.0 mm
    Precipitation - annual mean 81.24035 mm
    Precipitation - annual seasonality 0.95687705
    Precipitation - coldest quarter (Bio19) 134.0 mm
    Precipitation - driest month 42.266773 mm
    Precipitation - driest period (Bio14) 7.0 mm
    Precipitation - driest quarter (Bio17) 124.0 mm
    Precipitation - equinox seasonality ratio 0.97991383
    Precipitation - seasonality (Bio15) 39.0 mm
    Precipitation - spring or autumn season -0.020401895
    Precipitation - warmest quarter (Bio18) 346.0 mm
    Precipitation - wettest month 139.1463 mm
    Precipitation - wettest period (Bio13) 29.0 mm
    Precipitation - wettest quarter (Bio16) 347.0 mm
    Radiation - annual mean (Bio20) 18.4 MJ/m2/day
    Radiation - seasonality (Bio23) 24.0
    Radiation - warmest quarter (Bio26) 22.7 MJ/m2/day
    Temperature - annual max mean 21.26 degrees C
    Temperature - annual mean (Bio01) 16.1 degrees C
    Temperature - annual min mean 8.646667 degrees C
    Temperature - annual range 23.80545 degrees C
    Temperature - annual range (Bio07) 24.2 degrees C
    Temperature - coldest month min 2.01 degrees C
    Temperature - coldest period min (Bio06) 3.7 degrees C
    Temperature - coldest quarter mean (Bio11) 10.1 degrees C
    Temperature - diurnal range mean (Bio02) 11.5 degrees C
    Temperature - driest quarter mean (Bio09) 11.0 degrees C
    Temperature - isothermality (Bio03) 0.48 %
    Temperature - month hottest maximum 26.89 degrees C
    Temperature - seasonality (Bio04) 1.53
    Temperature - warmest month min 14.45 degrees C
    Temperature - warmest period max (Bio05) 27.8 degrees C
    Temperature - warmest quarter (Bio10) 21.3 degrees C
    Temperature - wettest quarter mean (Bio08) 21.3 degrees C
    Wind run - annual mean 163.41878 km/day
    WorldClim: Precipitation - annual 903.0 mm
    WorldClim: Precipitation - coldest quarter 156.0 mm
    WorldClim: Precipitation - driest month 39.0 mm
    WorldClim: Precipitation - driest quarter 143.0 mm
    WorldClim: Precipitation - seasonality 34.0
    WorldClim: Precipitation - warmest quarter 338.0 mm
    WorldClim: Precipitation - wettest month 115.0 mm
    WorldClim: Precipitation - wettest quarter 338.0 mm
    WorldClim: Temperature - annual mean 150.0 degrees C * 10
    WorldClim: Temperature - annual range 250.0 degrees C * 10
    WorldClim: Temperature - coldest month min 19.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 87.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 127.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 98.0 degrees C * 10
    WorldClim: Temperature - isothermality 50.0 %
    WorldClim: Temperature - seasonality 4538.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 269.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 203.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 203.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.089999996 degrees
    Distance - to coast 1.498332 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.3176476 km
    Euclidean Distance to Coast (metres) 100658.46 m
    Remoteness index 4.444325
    Hydrology
    Drainage - average 506.0 megalitres/5x5km/year
    Drainage - variability 167.0 %
    Runoff - average 1150.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 1047.61 m
    Social
    Population - density SLA 2006 p/sqkm) 0.45372012 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 61.309628
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 26.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.1 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 30.0 %
    Bulk density 0.8206838 Mg/m^3
    Carbon - organic 1.465885 %
    Clay % 37.37607 %
    Hydrologic conductivity - average saturated 45.555557 mm/h
    Moisture Index - annual mean (Bio28) 0.61
    Moisture Index - highest quarter mean (Bio32) 0.74
    Nutrient status 2.05 index
    Ph - soil 4.0 ph
    Soil depth 0.6 m
    Soil pedality 2.832906
    Water holding capacity 24000.0 mm
    Water stress index - month max 79.001755
    Weathering Intensity V2 1.58809 Weathering Intensity Index
    Topography
    Aspect 42.0 degrees
    Averaged Topographic Relief 539.25 metres
    Bathymetry and Elvation 9 sec 1046.0 m
    Elevation 1069.0 m
    Topographic Slope (degrees) 9.028797 degrees
    Topographic relief 298.3636 m
    Topographic slope (%) 15.94784 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.5527 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 80.0 %
    Gross Primary Productivity (2012-03-13) 0.0717 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 3.9 m^2 plant / m^2 ground
    NDVI Mean 88.0 NDVI x 100
    NPP Mean 15.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.8597 NDVI