Occurrence record: BOLD - Australian records - 2727542

GenomicDNA of Glyphis garricki | Northern River Shark

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 2727542
Other catalogue numbers recordID:601230;ProcessID:FOAF862-07;sampleID:BW-A3734
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer Thorburn, D.
Supplied as "D Thorburn"
Associated Occurrence Status Associated record
Inferred Associated Occurrences The occurrence is associated with a representative record.
For more information see Inferred associated occurrence details
License CC-BY-Int
State conservation Western Australia: Priority One
Data generalizations Location in Western Australia, Australia is already generalised to 0.1 degrees. Sensitive in WA, Name: Western Australia, Zone: STATE [Sensitive, WA DEC]
Field number WW023
Country conservation Endangered,
Occurrence status present
Abcd identification qualifier Not provided
Identification ID D. Thorburn

Event

Field number WW023
Record date Year: 2004, Month: 01, Day:
Date precision Day

Taxonomy

Scientific name Glyphis garricki
Taxon rank species
Common name Northern River Shark
Kingdom Animalia
Phylum Chordata
Class Chondrichthyes
Order Carcharhiniformes
Family Carcharhinidae
Genus Glyphis
Species Glyphis garricki
Taxonomic issues No issues
Name match metric Canonical name match
The supplied name was parsed into canonical form before a match was found.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Local government area Derby-West Kimberley (S)
Latitude -17.3
Longitude 123.7
Geodetic datum EPSG:4326
Coordinate precision Unknown
Coordinates generalised Location in Western Australia, Australia is already generalised to 0.1 degrees. Sensitive in WA, Name: Western Australia, Zone: STATE [Sensitive, WA DEC]
Biome Terrestrial

Additional properties

genbank accession EU398794
markercode COI-5P
nucleotides CCTTTATCTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTGAGTCTTCTAATCCGAGCTGAACTCGGACAACCTGGATCACTTTTGGGGGATGATCAGATTTATAATGTAATCGTAACTGCCCACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTCCCCTTAATAATTGGAGCACCAGACATAGCCTTTCCACGAATAAATAATATAAGTTTTTGACTTCTTCCACCATCATTCCTTCTTCTCCTTGCTTCTGCTGGAGTAGAAGCCGGAGCAGGTACTGGTTGAACAGTCTACCCTCCACTGGCTAGTAATCTAGCCCATGCTGGTCCATCTGTTGACTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATCTTAGCTTCAATCAACTTCATCACAACTATTATTAATATAAAACCACCAGCCATTTCTCAATATCAAACACCATTATTTGTTTGATCTATCCTTGTAACCACTATTCTTCTCCTTCTTTCACTTCCAGTTCTTGCAGCAGGAATTACAATATTACTCACAGACCGTAACCTCAATACTACATTCTTTGACCCTGCAGGTGGAGGAGACCCAATCCTTTATCAACATTTA
owner institution code Biodiversity Institute of Ontario
sequence last updated 2011-11-14T08:11:24Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Habitat incorrect for species Failed
    First of the month Warning
    First of the year Warning
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the century Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 44 tests that have not been run

    Inferred associated occurrence details

    This record is associated with the representative record. This mean another record has been detected to be similar to this record, and that the other record (the representative record) has the most detailed information for the occurrence. More information about the duplication detection methods and terminology in use is available here:

    Representative Record
    Record UUID 66970f0d-13a8-4045-b2e5-24e921f791f6
    Data Resource European Molecular Biology Laboratory Australian Mirror
    Coordinates -17.3,123.7
    Collector [Thorburn, D.]
    Year 2004
    Month 01
    Related records
    Record UUID 2ea1721d-f874-40df-a169-5a3835c28fac
    Data Resource BOLD - Australian records
    Coordinates -17.3,123.7
    Collector [Thorburn, D.]
    Year 2004
    Month 01
    Comments Collectors were identical
    Occurrence was compared without day
    Coordinates were identical
    Record UUID 22d8b43b-364d-41c0-a0f4-5fa09e3e8cab
    Data Resource BOLD - Australian records
    Coordinates -17.3,123.7
    Collector [Thorburn, D.]
    Year 2004
    Month 01
    Comments Collectors were identical
    Occurrence was compared without day
    Coordinates were identical
    Record UUID d4f1f1a7-fd3d-435a-b07b-a478ba809979
    Data Resource European Molecular Biology Laboratory Australian Mirror
    Coordinates -17.3,123.7
    Collector [Thorburn, D.]
    Year 2004
    Month 01
    Comments Collectors were identical
    Occurrence was compared without day
    Coordinates were identical
    Record UUID 2ea1721d-f874-40df-a169-5a3835c28fac
    Data Resource BOLD - Australian records
    Coordinates -17.3,123.7
    Collector [Thorburn, D.]
    Year 2004
    Month 01
    Comments Collectors were identical
    Occurrence was compared without day
    Coordinates were identical
    Record UUID 22d8b43b-364d-41c0-a0f4-5fa09e3e8cab
    Data Resource BOLD - Australian records
    Coordinates -17.3,123.7
    Collector [Thorburn, D.]
    Year 2004
    Month 01
    Comments Collectors were identical
    Occurrence was compared without day
    Coordinates were identical
    Record UUID d4f1f1a7-fd3d-435a-b07b-a478ba809979
    Data Resource European Molecular Biology Laboratory Australian Mirror
    Coordinates -17.3,123.7
    Collector [Thorburn, D.]
    Year 2004
    Month 01
    Comments Collectors were identical
    Occurrence was compared without day
    Coordinates were identical

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Freshwater Kimberley Rivers & Streams
    Global 200 priority ecoregions - Marine Western Australia Marine
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Irrigation practice - dominant No irrigation
    Land use Other minimal uses
    NRM Regions 2010 Rangelands
    NRM Regions 2014 Rangelands
    NRM Regions 2015 Rangelands
    NRM Regions 2017 Rangelands Region
    NRM Regions 2017 (Qld 2019) Rangelands Region
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    Freshwater Ecoregions of the World Kimberley
    IBRA 6 Regions Dampierland
    IBRA 6 Sub Regions Fitzroy Trough
    IBRA 7 Regions Dampierland
    IBRA 7 Subregions Fitzroy Trough
    Terrestrial Ecoregional Boundaries Kimberly Tropical Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Temperature and moisture are more seasonal strongly developed wet and dry seasons and the growing season is shorter
    Koppen Climate Classification (All Classes) Grassland: hot (winter drought)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Hummock grassland (semi-arid/arid)
    Hydrology
    Drainage Divisions Level 1 Tanami-Timor Sea Coast
    Drainage Divisions Level 2 FITZROY RIVER (WA)
    River Regions FITZROY RIVER (WA)
    Land Management
    Western Australian Biodiversity Science Research Priority Regions Kimberley
    Marine
    Marine Ecoregions of the World Bonaparte Coast
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Commonwealth Electoral Boundaries Durack
    Local Government Areas 2011 Derby-West Kimberley (S)
    Local Government Areas 2012 deprecated Derby-West Kimberley
    Local Government Areas PSMA 2018 SHIRE OF DERBY-WEST KIMBERLEY
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 555
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1162
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) DERBY - WEST KIMBERLEY
    PSMA ABS SA3 Statistical Areas (2016) KIMBERLEY
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - OUTBACK (NORTH)
    PSMA Commonwealth Electoral Boundaries (2016) DURACK
    PSMA Commonwealth Electoral Boundaries (2018) DURACK
    PSMA Indigenous Areas (2016) OUTER DERBY - WEST KIMBERLEY
    PSMA Indigenous Locations (2016) OUTER DERBY - WEST KIMBERLEY
    PSMA Indigenous Regions (2016) WEST KIMBERLEY
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (WA)
    PSMA State Electoral Boundaries (2016) MINING AND PASTORAL REGION
    PSMA State Electoral Boundaries (2018) KIMBERLEY, MP
    PSMA States (2016) WESTERN AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (WA)
    Statistical Local Areas Derby-West Kimberley (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Canning Region
    Surface Geology of Australia Qe
    Topography
    Physiographic Provinces of Australia Kimberley Province
    Physiographic Regions 2011 Fitzroy Plains
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Ephemeral and Permanent Water Features
    NVIS 4.1 Major Vegetation Groups Naturally bare - sand, rock, claypan, mudflat
    NVIS 4.1 Major Vegetation Subgroups Naturally bare, sand, rock, claypan, mudflat
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Modified
    Vegetation types - native Naturally bare - sand, rock, claypan
    Vegetation types - present Naturally bare - sand, rock, claypan, mudflats

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 6180020.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6879
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.8278
    Endemism 0.01497616
    Endemism (Non-marine) 0.020689443
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 5.0 frequency
    Occurrence Density 2358.0 frequency
    Shannon Diversity (H) 4.4746895 index
    Species Richness 260.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 1.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.25950903
    2030A1BMk35M: Evaporation - month min 184.55 mm
    2030A1BMk35M: Precipitation - annual mean 58.401665 mm
    2030A1BMk35M: Precipitation - driest month 0.16 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.07909075
    2030A1BMk35M: Precipitation - spring or autumn season -10.84069
    2030A1BMk35M: Temperature - annual max mean 35.785 degrees C
    2030A1BMk35M: Temperature - annual min mean 22.74 degrees C
    2030A1BMk35M: Temperature - annual range 22.809998 degrees C
    Aridity index - annual mean 0.25280106
    Aridity index - month max 0.9301024
    Aridity index - month min 0.004474209
    Evaporation - annual mean 215.10992 (ml/5km x 5km pixel)
    Evaporation - average 14634.0 ml
    Evaporation - month max 275.14297 mm
    Evaporation - month min 169.3 mm
    Evaporation - variability 30.0 %
    Growth index C3 macrotherm plants - annual mean 0.23 index
    Growth index C3 mesotherm plants - annual mean 0.05 index
    Growth index C4 megatherm plants - annual mean 0.23 index
    Humidity - annual mean relative 67.008156 %
    Humidity - annual mean relative 3pm 58.56408 %
    Humidity - month max relative 80.14841 %
    Humidity - month max relative 3pm 68.57762 %
    Humidity - month min relative 51.768543 %
    Humidity - month min relative 3pm 51.768543 %
    Precipitation - annual 645.0 mm
    Precipitation - annual (Bio12) 763.0 mm
    Precipitation - annual mean 53.5 mm
    Precipitation - annual seasonality 7.9076924
    Precipitation - coldest quarter (Bio19) 17.0 mm
    Precipitation - driest month 1.0 mm
    Precipitation - driest period (Bio14) 0.0 mm
    Precipitation - driest quarter (Bio17) 4.0 mm
    Precipitation - equinox seasonality ratio 0.121212125
    Precipitation - seasonality (Bio15) 138.0 mm
    Precipitation - spring or autumn season -6.904762
    Precipitation - warmest quarter (Bio18) 295.0 mm
    Precipitation - wettest month 192.0 mm
    Precipitation - wettest period (Bio13) 61.0 mm
    Precipitation - wettest quarter (Bio16) 614.0 mm
    Radiation - annual mean (Bio20) 22.2 MJ/m2/day
    Radiation - seasonality (Bio23) 15.0
    Radiation - warmest quarter (Bio26) 25.1 MJ/m2/day
    Temperature - annual max mean 33.658333 degrees C
    Temperature - annual mean (Bio01) 28.1 degrees C
    Temperature - annual min mean 21.13 degrees C
    Temperature - annual range 28.800018 degrees C
    Temperature - annual range (Bio07) 23.2 degrees C
    Temperature - coldest month min 14.3 degrees C
    Temperature - coldest period min (Bio06) 14.7 degrees C
    Temperature - coldest quarter mean (Bio11) 23.5 degrees C
    Temperature - diurnal range mean (Bio02) 12.9 degrees C
    Temperature - driest quarter mean (Bio09) 26.4 degrees C
    Temperature - isothermality (Bio03) 0.56 %
    Temperature - month hottest maximum 36.78 degrees C
    Temperature - seasonality (Bio04) 1.03
    Temperature - warmest month min 25.76 degrees C
    Temperature - warmest period max (Bio05) 37.9 degrees C
    Temperature - warmest quarter (Bio10) 31.3 degrees C
    Temperature - wettest quarter mean (Bio08) 30.5 degrees C
    Wind run - annual mean 159.89967 km/day
    WorldClim: Precipitation - annual 568.0 mm
    WorldClim: Precipitation - coldest quarter 13.0 mm
    WorldClim: Precipitation - driest month 0.0 mm
    WorldClim: Precipitation - driest quarter 2.0 mm
    WorldClim: Precipitation - seasonality 131.0
    WorldClim: Precipitation - warmest quarter 238.0 mm
    WorldClim: Precipitation - wettest month 178.0 mm
    WorldClim: Precipitation - wettest quarter 447.0 mm
    WorldClim: Temperature - annual mean 279.0 degrees C * 10
    WorldClim: Temperature - annual range 214.0 degrees C * 10
    WorldClim: Temperature - coldest month min 151.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 233.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 121.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 268.0 degrees C * 10
    WorldClim: Temperature - isothermality 56.0 %
    WorldClim: Temperature - seasonality 2983.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 365.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 308.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 301.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.14 km x 100
    Distance - to non-permanent water (weighted) 0.3498571 degrees
    Distance - to permanent water (weighted) 0.0 km
    Euclidean Distance to Coast (metres) 6177.1074 m
    Remoteness index 11.142117
    Hydrology
    Drainage - average 123.0 megalitres/5x5km/year
    Drainage - variability 174.0 %
    Runoff - average 3484.0 megalitres/5x5km/year
    Water Observations From Space 4.1791043 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.1 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 80.99999
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 123.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.45 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 13.0 %
    Bulk density 0.94526315 Mg/m^3
    Carbon - organic 0.08046481 %
    Clay % 30.421053 %
    Hydrologic conductivity - average saturated 12.029412 mm/h
    Moisture Index - annual mean (Bio28) 0.31
    Moisture Index - highest quarter mean (Bio32) 0.91
    Nutrient status 1.0 index
    Soil depth 1.1 m
    Soil pedality 2.7263157
    Water holding capacity 23000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 2.74669 Weathering Intensity Index
    Topography
    Aspect 268.0 degrees
    Averaged Topographic Relief 18.875 metres
    Bathymetry and Elvation 9 sec 4.0 m
    Elevation 5.0 m
    Topographic Slope (degrees) 0.113760546 degrees
    Topographic relief 1.61911 m
    Topographic slope (%) 0.08159366 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.0993 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 10.0 %
    Gross Primary Productivity (2012-03-13) 0.0044 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.2 m^2 plant / m^2 ground
    NDVI Mean 22.0 NDVI x 100
    NPP Mean 1.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.1756 NDVI