Occurrence record: BOLD - Australian records - 2727542
GenomicDNA
of
Glyphis garricki
| Northern River Shark
Dataset
| Data provider | Barcode of Life |
| Data resource | BOLD - Australian records |
| Catalogue Number | 2727542 |
| Other catalogue numbers | recordID:601230;ProcessID:FOAF862-07;sampleID:BW-A3734 |
| Basis of record |
GenomicDNA
Supplied basis "Genomic DNA" |
| Preparations | nullnull |
| Collector/Observer |
Thorburn, D.
Supplied as "D Thorburn" |
| Associated Occurrence Status | Associated record |
| Inferred Associated Occurrences |
The occurrence is associated with a representative record.
For more information see Inferred associated occurrence details |
| License | CC-BY-Int |
| State conservation | Western Australia: Priority One |
| Data generalizations | Location in Western Australia, Australia is already generalised to 0.1 degrees. Sensitive in WA, Name: Western Australia, Zone: STATE [Sensitive, WA DEC] |
| Field number | WW023 |
| Country conservation | Endangered, |
| Occurrence status | present |
| Abcd identification qualifier | Not provided |
| Identification ID | D. Thorburn |
Event
| Field number | WW023 |
| Record date | Year: 2004, Month: 01, Day: |
| Date precision | Day |
Taxonomy
| Scientific name | Glyphis garricki |
| Taxon rank | species |
| Common name | Northern River Shark |
| Kingdom | Animalia |
| Phylum | Chordata |
| Class | Chondrichthyes |
| Order | Carcharhiniformes |
| Family | Carcharhinidae |
| Genus | Glyphis |
| Species | Glyphis garricki |
| Taxonomic issues | No issues |
| Name match metric |
Canonical name match
The supplied name was parsed into canonical form before a match was found. |
| Name parse type | SCIENTIFIC |
Geospatial
| Country | Australia |
| State or Territory | Western Australia |
| Local government area | Derby-West Kimberley (S) |
| Latitude | -17.3 |
| Longitude | 123.7 |
| Geodetic datum | EPSG:4326 |
| Coordinate precision | Unknown |
| Coordinates generalised | Location in Western Australia, Australia is already generalised to 0.1 degrees. Sensitive in WA, Name: Western Australia, Zone: STATE [Sensitive, WA DEC] |
| Biome | Terrestrial |
Additional properties
| genbank accession | EU398794 |
| markercode | COI-5P |
| nucleotides | CCTTTATCTAATTTTTGGTGCATGAGCAGGTATAGTTGGAACAGCCCTGAGTCTTCTAATCCGAGCTGAACTCGGACAACCTGGATCACTTTTGGGGGATGATCAGATTTATAATGTAATCGTAACTGCCCACGCTTTTGTAATAATCTTTTTTATAGTTATACCAATTATAATTGGTGGTTTCGGAAATTGACTAGTCCCCTTAATAATTGGAGCACCAGACATAGCCTTTCCACGAATAAATAATATAAGTTTTTGACTTCTTCCACCATCATTCCTTCTTCTCCTTGCTTCTGCTGGAGTAGAAGCCGGAGCAGGTACTGGTTGAACAGTCTACCCTCCACTGGCTAGTAATCTAGCCCATGCTGGTCCATCTGTTGACTTAGCTATTTTCTCTCTTCACTTAGCCGGTGTTTCATCAATCTTAGCTTCAATCAACTTCATCACAACTATTATTAATATAAAACCACCAGCCATTTCTCAATATCAAACACCATTATTTGTTTGATCTATCCTTGTAACCACTATTCTTCTCCTTCTTTCACTTCCAGTTCTTGCAGCAGGAATTACAATATTACTCACAGACCGTAACCTCAATACTACATTCTTTGACCCTGCAGGTGGAGGAGACCCAATCCTTTATCAACATTTA |
| owner institution code | Biodiversity Institute of Ontario |
| sequence last updated | 2011-11-14T08:11:24Z |
Data quality tests
| Test name | Result |
| Habitat incorrect for species | Failed |
| First of the month | Warning |
| First of the year | Warning |
| Occurrence status assumed to be present | Warning |
| Geodetic datum assumed WGS84 | Warning |
| Basis of record not supplied | Passed |
| Basis of record badly formed | Passed |
| Invalid collection date | Passed |
| Incomplete collection date | Passed |
| First of the century | Passed |
| Collector name unparseable | Passed |
| Missing catalogue number | Passed |
| Data are generalised | Passed |
| Name not recognised | Passed |
| Invalid scientific name | Passed |
| Name not in national checklists | Passed |
| Decimal coordinates not supplied | Passed |
| Coordinates are transposed | Passed |
| Coordinates are out of range for species | Passed |
| Supplied coordinates are zero | Passed |
| Zero latitude | Passed |
| Zero longitude | Passed |
| Supplied country not recognised | Passed |
| Location not supplied | Passed |
| Country inferred from coordinates | Passed |
| Supplied coordinates centre of state | Passed |
| Coordinates centre of country | Passed |
| Missing geodetic datum | Passed |
| Coordinates dont match supplied state | Passed |
| Show/Hide 13 missing properties | |
| Show/Hide 44 tests that have not been run | |
Inferred associated occurrence details
This record is associated with the representative record. This mean another record has been detected to be similar to this record, and that the other record (the representative record) has the most detailed information for the occurrence. More information about the duplication detection methods and terminology in use is available here:
| Representative Record | |||
| Record UUID | 66970f0d-13a8-4045-b2e5-24e921f791f6 | ||
| Data Resource | European Molecular Biology Laboratory Australian Mirror | ||
| Coordinates | -17.3,123.7 | ||
| Collector | [Thorburn, D.] | ||
| Year | 2004 | ||
| Month | 01 | ||
| Related records | |||
| Record UUID | 2ea1721d-f874-40df-a169-5a3835c28fac | ||
| Data Resource | BOLD - Australian records | ||
| Coordinates | -17.3,123.7 | ||
| Collector | [Thorburn, D.] | ||
| Year | 2004 | ||
| Month | 01 | ||
| Comments |
Collectors were identical
Occurrence was compared without day Coordinates were identical |
||
| Record UUID | 22d8b43b-364d-41c0-a0f4-5fa09e3e8cab | ||
| Data Resource | BOLD - Australian records | ||
| Coordinates | -17.3,123.7 | ||
| Collector | [Thorburn, D.] | ||
| Year | 2004 | ||
| Month | 01 | ||
| Comments |
Collectors were identical
Occurrence was compared without day Coordinates were identical |
||
| Record UUID | d4f1f1a7-fd3d-435a-b07b-a478ba809979 | ||
| Data Resource | European Molecular Biology Laboratory Australian Mirror | ||
| Coordinates | -17.3,123.7 | ||
| Collector | [Thorburn, D.] | ||
| Year | 2004 | ||
| Month | 01 | ||
| Comments |
Collectors were identical
Occurrence was compared without day Coordinates were identical |
||
| Record UUID | 2ea1721d-f874-40df-a169-5a3835c28fac | ||
| Data Resource | BOLD - Australian records | ||
| Coordinates | -17.3,123.7 | ||
| Collector | [Thorburn, D.] | ||
| Year | 2004 | ||
| Month | 01 | ||
| Comments |
Collectors were identical
Occurrence was compared without day Coordinates were identical |
||
| Record UUID | 22d8b43b-364d-41c0-a0f4-5fa09e3e8cab | ||
| Data Resource | BOLD - Australian records | ||
| Coordinates | -17.3,123.7 | ||
| Collector | [Thorburn, D.] | ||
| Year | 2004 | ||
| Month | 01 | ||
| Comments |
Collectors were identical
Occurrence was compared without day Coordinates were identical |
||
| Record UUID | d4f1f1a7-fd3d-435a-b07b-a478ba809979 | ||
| Data Resource | European Molecular Biology Laboratory Australian Mirror | ||
| Coordinates | -17.3,123.7 | ||
| Collector | [Thorburn, D.] | ||
| Year | 2004 | ||
| Month | 01 | ||
| Comments |
Collectors were identical
Occurrence was compared without day Coordinates were identical |
||
