Occurrence record: BOLD - Australian records - 3305219

GenomicDNA of LEPIDOPTERA | Moths recorded on 2007-04-19

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3305219
Other catalogue numbers recordID:1147212;ProcessID:LAUSM077-09;sampleID:AZ-07-2005
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Zwick, A. Andreas
Supplied as "Andreas Zwick"
Life stage adult
License CC-BY-Int
Field number AZ-07-2005
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Andreas Zwick

Event

Field number AZ-07-2005
Record date 2007-04-19
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Local government area Dundas (S)
Latitude -32.0672
Longitude 122.448
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession GU695925
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGTATTTGGGCAGGAATAGTAGGTACCTCTTTAAGTTTATTAATTCGAGCAGAATTAGGAAATCCTGGATCTTTAATTGGAGATGACCAAATCTATAATACTATTGTTACAGCTCATGCCTTTATTATAATTTTTTTTATAGTTATACCTATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATATTAGGAGCTCCCGATATAGCTTTCCCTCGAATAAATAATATAAGATTTTGATTACTCCCCCCATCCTTAACTCTTTTAATTTCAAGAAGAATCGTAGAAAATGGAGCTGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATAGAGGAAGTTCTGTTGATTTAGCTATCTTTTCCCTACACTTAGCAGGTATTTCATCAATCTTAGGAGCAATTAACTTTATTACAACAATTATTAATATACGATTAAATAATATATCATTTGATCAAATACCTTTATTTGTATGAGCAGTAGGAATTACAGCATTACTCTTATTATTATCTCTTCCTGTTTTAGCAGGAGCTATTACAATACTTCTCACAGATCGAAATCTTAATACATCATTTTTTGATCCTGCTGGAGGAGGAGACCCAATTTTATATCAACACTTATTT
owner institution code University of Maryland
sequence last updated 2011-11-14T08:11:27Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No practices
    Fallow practice - dominant (number) No practices
    Global 200 priority ecoregions - Freshwater Southwest Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Southwestern Australia Forests and Scrub
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 Rangelands
    NRM Regions 2014 Rangelands
    NRM Regions 2015 Rangelands
    NRM Regions 2017 Rangelands Region
    NRM Regions 2017 (Qld 2019) Rangelands Region
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Rangelands Region
    Biodiversity
    Freshwater Ecoregions of the World Paleo
    IBRA 6 Regions Coolgardie
    IBRA 6 Sub Regions Eastern Goldfield
    IBRA 7 Regions Coolgardie
    IBRA 7 Subregions Eastern Goldfield
    Terrestrial Ecoregional Boundaries Coolgardie Woodlands
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Semi-arid climate that is too dry to support field crops. Soil moisture tends to be greatest in winter
    Koppen Climate Classification (All Classes) Grassland: warm (persistently dry)
    Koppen Climate Classification (Major Classes) Grassland
    Fire
    Fire regime niches Eucalypt woodland (temperate)
    Hydrology
    Drainage Divisions Level 1 South Western Plateau
    Drainage Divisions Level 2 SALT LAKE
    River Regions SALT LAKE
    Land Management
    Western Australian Biodiversity Science Research Priority Regions Yilgarn/GreatWesternWoodlands
    Marine
    Marine Ecoregions of the World Leeuwin
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Commonwealth Electoral Boundaries O'Connor
    Local Government Areas 2011 Dundas (S)
    Local Government Areas 2012 deprecated Dundas
    Local Government Areas PSMA 2018 SHIRE OF DUNDAS
    Native Title Determinations (13/7/2020) Ngadju WCD2014/004
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 48
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 493
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) KAMBALDA - COOLGARDIE - NORSEMAN
    PSMA ABS SA3 Statistical Areas (2016) GOLDFIELDS
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - OUTBACK (SOUTH)
    PSMA Commonwealth Electoral Boundaries (2016) O'CONNOR
    PSMA Commonwealth Electoral Boundaries (2018) O'CONNOR
    PSMA Indigenous Areas (2016) KALGOORLIE - DUNDAS - GOLDFIELDS
    PSMA Indigenous Locations (2016) KALGOORLIE - DUNDAS
    PSMA Indigenous Regions (2016) KALGOORLIE
    PSMA Localities (2018) FRASER RANGE
    PSMA Remoteness Areas (2016) Very Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (WA)
    PSMA State Electoral Boundaries (2016) MINING AND PASTORAL REGION
    PSMA State Electoral Boundaries (2018) MINING AND PASTORAL REGION
    PSMA States (2016) WESTERN AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (WA)
    Statistical Local Areas Dundas (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Fraser Region
    Surface Geology of Australia Qrc
    Topography
    Physiographic Provinces of Australia Yilgarn Plateau Province
    Physiographic Regions 2011 Southern Goldfields Plateau
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Mallee Woodland
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus woodlands with a chenopod or samphire understorey
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Modified
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 6180020.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.3428
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.010652996
    Endemism (Non-marine) 0.01067021
    Mammals – Fritz et al 2009 - 0.5 degree 0.2564
    Migratory species (2008) 2.0 frequency
    Occurrence Density 294.0 frequency
    Shannon Diversity (H) 4.1992354 index
    Species Richness 109.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 1.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.17905182
    2030A1BMk35M: Evaporation - month min 61.13 mm
    2030A1BMk35M: Precipitation - annual mean 22.144167 mm
    2030A1BMk35M: Precipitation - driest month 11.43 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.72394043
    2030A1BMk35M: Precipitation - spring or autumn season -0.3747408
    2030A1BMk35M: Temperature - annual max mean 25.794167 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.324166 degrees C
    2030A1BMk35M: Temperature - annual range 27.77002 degrees C
    Aridity index - annual mean 0.18133107
    Aridity index - month max 0.44771323
    Aridity index - month min 0.06149641
    Evaporation - annual mean 167.89671 (ml/5km x 5km pixel)
    Evaporation - average 7308.0 ml
    Evaporation - month max 302.2001 mm
    Evaporation - month min 62.54003 mm
    Evaporation - variability 25.0 %
    Growth index C3 macrotherm plants - annual mean 0.03 index
    Growth index C3 mesotherm plants - annual mean 0.1 index
    Growth index C4 megatherm plants - annual mean 0.02 index
    Humidity - annual mean relative 74.21487 %
    Humidity - annual mean relative 3pm 58.074734 %
    Humidity - month max relative 86.9501 %
    Humidity - month max relative 3pm 71.284935 %
    Humidity - month min relative 47.528625 %
    Humidity - month min relative 3pm 47.528625 %
    Precipitation - annual 257.0 mm
    Precipitation - annual (Bio12) 290.0 mm
    Precipitation - annual mean 22.049921 mm
    Precipitation - annual seasonality -0.19244358
    Precipitation - coldest quarter (Bio19) 76.0 mm
    Precipitation - driest month 18.0 mm
    Precipitation - driest period (Bio14) 3.0 mm
    Precipitation - driest quarter (Bio17) 58.0 mm
    Precipitation - equinox seasonality ratio 0.7368421
    Precipitation - seasonality (Bio15) 24.0 mm
    Precipitation - spring or autumn season -0.3508772
    Precipitation - warmest quarter (Bio18) 77.0 mm
    Precipitation - wettest month 31.0 mm
    Precipitation - wettest period (Bio13) 9.0 mm
    Precipitation - wettest quarter (Bio16) 84.0 mm
    Radiation - annual mean (Bio20) 18.9 MJ/m2/day
    Radiation - seasonality (Bio23) 35.0
    Radiation - warmest quarter (Bio26) 25.6 MJ/m2/day
    Temperature - annual max mean 23.735 degrees C
    Temperature - annual mean (Bio01) 17.4 degrees C
    Temperature - annual min mean 9.660833 degrees C
    Temperature - annual range 26.699982 degrees C
    Temperature - annual range (Bio07) 28.2 degrees C
    Temperature - coldest month min 4.34 degrees C
    Temperature - coldest period min (Bio06) 4.4 degrees C
    Temperature - coldest quarter mean (Bio11) 11.3 degrees C
    Temperature - diurnal range mean (Bio02) 14.3 degrees C
    Temperature - driest quarter mean (Bio09) 14.9 degrees C
    Temperature - isothermality (Bio03) 0.51 %
    Temperature - month hottest maximum 31.43 degrees C
    Temperature - seasonality (Bio04) 1.61
    Temperature - warmest month min 14.86 degrees C
    Temperature - warmest period max (Bio05) 32.6 degrees C
    Temperature - warmest quarter (Bio10) 23.3 degrees C
    Temperature - wettest quarter mean (Bio08) 12.2 degrees C
    Wind run - annual mean 236.9049 km/day
    WorldClim: Precipitation - annual 287.0 mm
    WorldClim: Precipitation - coldest quarter 84.0 mm
    WorldClim: Precipitation - driest month 19.0 mm
    WorldClim: Precipitation - driest quarter 59.0 mm
    WorldClim: Precipitation - seasonality 21.0
    WorldClim: Precipitation - warmest quarter 62.0 mm
    WorldClim: Precipitation - wettest month 35.0 mm
    WorldClim: Precipitation - wettest quarter 95.0 mm
    WorldClim: Temperature - annual mean 171.0 degrees C * 10
    WorldClim: Temperature - annual range 262.0 degrees C * 10
    WorldClim: Temperature - coldest month min 52.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 111.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 132.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 194.0 degrees C * 10
    WorldClim: Temperature - isothermality 50.0 %
    WorldClim: Temperature - seasonality 4544.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 314.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 228.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 120.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.084852815 degrees
    Distance - to coast 1.816618 km x 100
    Distance - to non-permanent water (weighted) 0.084852815 degrees
    Distance - to permanent water (weighted) 1.6161683 km
    Euclidean Distance to Coast (metres) 115469.92 m
    Remoteness index 12.293126
    Hydrology
    Drainage - average 34.0 megalitres/5x5km/year
    Drainage - variability 308.0 %
    Runoff - average 96.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.0 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 38.220184
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 90.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.45 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 22.0 %
    Bulk density 1.5016174 Mg/m^3
    Carbon - organic 0.7696845 %
    Clay % 35.59121 %
    Hydrologic conductivity - average saturated 48.57143 mm/h
    Moisture Index - annual mean (Bio28) 0.19
    Moisture Index - highest quarter mean (Bio32) 0.36
    Nutrient status 1.6 index
    Soil depth 0.7 m
    Soil pedality 2.516913
    Water holding capacity 48000.0 mm
    Water stress index - month max 40.294193
    Weathering Intensity V2 3.25386 Weathering Intensity Index
    Topography
    Aspect 86.0 degrees
    Averaged Topographic Relief 47.833332 metres
    Bathymetry and Elvation 9 sec 305.0 m
    Elevation 305.0 m
    Topographic Slope (degrees) 0.46884358 degrees
    Topographic relief 9.585999 m
    Topographic slope (%) 0.5622172 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.1879 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 33.0 %
    Fractional Cover - Bare Soil (2012-03-05) 30.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 38.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 32.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.016 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.7 m^2 plant / m^2 ground
    NDVI Mean 54.0 NDVI x 100
    NPP Mean 7.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3724 NDVI