Occurrence record: BOLD - Australian records - 3774322

GenomicDNA of LEPIDOPTERA | Moths recorded on 1979-10-22

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3774322
Other catalog numbers recordID:1657814;ProcessID:ANICO667-10;sampleID:10ANIC-11662
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Hacobian, B.
Supplied as "B.Hacobian"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 1979-10-22
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province New South Wales
Locality Warrumbungle Shire (A)
Locality NE of Baradine
Latitude -30.949
Longitude 149.066
Geodetic datum EPSG:4326
Coordinate precision Unknown
Georeference protocol Google Earth
Biome Terrestrial

Additional properties

genbank accession HQ923626
markercode COI-5P
nucleotides AACTTTATATTTTATTTTTGGTATTTGAGCAGGATTAGTAGGAACTTCTCTTAGACTTTTAATTCGAGCTGAATTAGGTAATCCTGGATCTTTAATTGGAGATGATCAAATTTATAACACTATTGTAACTGCTCATGCATTCATTATAATTTTTTTTATAGTTATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTACCTTTAATACTGGGAGCACCAGATATGGCATTTCCACGTATAAATAATATAAGATTTTGATTACTTCCCCCTTCTATTACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGAGCTGGAACTGGATGAACTGTATATCCACCTTTATCCTCAAATATTGCCCATGGAGGTAGATCAGTTGATTTAGCTATTTTTTCATTACATTTAGCTGGAATTTCATCAATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATACGATTAAATAATTTATCATTTGATCAAATACCATTATTTGTCTGAGCTGTTGGAATTACAGCATTTTTATTATTATTATCATTACCTGTTTTAGCTGGAGCTATTACTATATTATTAACAGATCGAAATTTAAATACATCATTTTTTGATCCTGCAGGAGGAGGAGATCCTATTTTATATCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:44Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Missing georeferenced protocol Passed
    Coordinates dont match supplied state Passed
    Show/Hide 12 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Irrigation practice - dominant 6. Local knowledge
    Land use Urban intensive uses
    Murray Darling Basin Authority Water Quality Zones Upland
    Murray-Darling Basin Boundary Murray-Darling Basin Boundary
    Murray-Darling Basin Ground Water Plan Areas GW13
    Murray-Darling Basin Ground Water Plan Areas (2018) NSW Murray���Darling Basin Fractured Rock
    Murray-Darling Basin Ground Water SDL Resource Units (2018) Gunnedah-Oxley Basin MDB (GS17)
    Murray-Darling Basin Surface Water Plan Areas SW14
    Murray-Darling Basin Surface Water Plan Areas (2019) Namoi
    Murray-Darling Basin Surface Water SDL Resource Units SS21
    Murray-Darling Basin Surface Water SDL Resource Units (2019) Namoi
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Valleys NAMOI
    Murray-Darling Basin Sustainable Rivers Audit (SRA) Zones slopes
    NRM Regions 2010 Namoi
    NRM Regions 2014 Central West
    NRM Regions 2015 Central West
    NRM Regions 2017 Central West
    NRM Regions 2017 (Qld 2019) Central West
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Central West
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions Brigalow Belt South
    IBRA 6 Sub Regions Pilliga
    IBRA 7 Regions Brigalow Belt South
    IBRA 7 Subregions Pilliga
    Terrestrial Ecoregional Boundaries Brigalow Tropical Savanna
    World Anthropogenic Biomes (2000) Residential rangelands
    Climate
    Agroclimatic classification of Australia Most plant growth in summer, although summers are moisture limiting. Temperature limits growth in winter
    Koppen Climate Classification (All Classes) Temperate: no dry season (hot summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Unclassified
    Hydrology
    Drainage Divisions Level 1 Murray-Darling Basin
    Drainage Divisions Level 2 DARLING RIVER
    River Regions NAMOI RIVER
    Marine
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Parkes
    Local Government Areas 2011 Warrumbungle Shire (A)
    Local Government Areas 2012 deprecated Warrumbungle Shire
    Local Government Areas PSMA 2018 WARRUMBUNGLE SHIRE COUNCIL
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water Barkindji, Bigambul, Budjiti, Euahlayi, Guwamu/Kooma, Kambuwal, Gomeroi/Kamilaroi, Kunja, Kwiambul, Maljangapa, Murrawarri, Ngarabal, Ngemba, Wailwan, Wiradjuri
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Ground Water (2019) Barkandji, Barapa Barapa, Bigambul, Budjiti, Euahlayi, Githabul, Gomeroi/Kamilaroi, Guwamu (Kooma), Kambuwal, Kunja, Kwiambul, Maljangapa, Maraura, Murrawarri, Mutthi Mutthi, Nari Nari, Ngarabal, Ngemba, Ngiyampaa, Nyeri Nyeri, Tati Tati, Wadi Wadi, Wail
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water Gomeroi/Kamilaroi
    Murray-Darling Basin Water Resource Planning Areas Traditional Owners - Surface Water (2019) Gomeroi/Kamilaroi
    NSW Local Land Services Regions Central West
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 3
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 818
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF NSW
    PSMA ABS SA2 Statistical Areas (2016) COONABARABRAN
    PSMA ABS SA3 Statistical Areas (2016) DUBBO
    PSMA ABS SA4 Statistical Areas (2016) FAR WEST AND ORANA
    PSMA Commonwealth Electoral Boundaries (2016) PARKES
    PSMA Commonwealth Electoral Boundaries (2018) PARKES
    PSMA Indigenous Areas (2016) WARRUMBUNGLE SHIRE
    PSMA Indigenous Locations (2016) COONABARABRAN - SURROUNDS
    PSMA Indigenous Regions (2016) DUBBO
    PSMA Localities (2018) BARADINE
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) BOUNDED LOCALITY
    PSMA Section of State Range (2016) 500 OR MORE
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (NSW)
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) BARWON
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) BARADINE (L)
    Statistical Local Areas Warrumbungle Shire (A)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Surat Region
    Surface Geology of Australia Czs
    Topography
    Physiographic Provinces of Australia Macquarie Uplands Province
    Physiographic Regions 2011 Warrumbungle Peaks
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Other native forest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Replaced
    Vegetation types - native Callitris forests and woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Beef numbers 2253746.0 dse
    Dairy numbers 157.0 dse
    Dolomite (acidity) 0.0 t/ha
    Dolomite (physical) 1.0 t/ha
    Gypsum 0.0 t/ha
    Lime 1.0 t/ha
    Natural resource management expenditure 3910963.0 $
    Natural resource management expenditure - additional 0.0 $/ha
    Nitrogen 0.040862 t/ha
    Sheep numbers 825995.0 dse
    Area management
    Phosphorus 0.012452 t/ha
    Potassium 0.051346 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.9358
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.4163
    Endemism 0.005650071
    Endemism (Non-marine) 0.0059135146
    Mammals – Fritz et al 2009 - 0.5 degree 0.3689
    Migratory species (2008) 5.0 frequency
    Occurrence Density 7411.0 frequency
    Shannon Diversity (H) 5.255862 index
    Species Richness 618.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 4.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.3334405
    2030A1BMk35M: Aridity index - month max 0.64471054
    2030A1BMk35M: Aridity index - month min 0.1780376
    2030A1BMk35M: Evaporation - annual mean 167.93584 mm
    2030A1BMk35M: Evaporation - month max 288.74 mm
    2030A1BMk35M: Evaporation - month min 60.12 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.12 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.2 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.09 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 65.095795 %
    2030A1BMk35M: Humidity - month max relative 3pm 77.031235 %
    2030A1BMk35M: Humidity - month min relative 3pm 55.559727 %
    2030A1BMk35M: Precipitation - annual mean 46.334167 mm
    2030A1BMk35M: Precipitation - driest month 29.11 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0584688
    2030A1BMk35M: Precipitation - max difference between successive months 0.7587098 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -0.7645191 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 1.816412
    2030A1BMk35M: Precipitation - spring or autumn season 0.05800862
    2030A1BMk35M: Precipitation - summer or winter season 0.80873096
    2030A1BMk35M: Precipitation - wettest month 81.19 mm
    2030A1BMk35M: Precipitation deficit - annual mean -121.60167 mm
    2030A1BMk35M: Precipitation deficit - month max -229.76 mm
    2030A1BMk35M: Precipitation deficit - month min -21.36 mm
    2030A1BMk35M: Radiation - max month precipitation modified 26.15 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 18.618334 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 9.65 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 26.9875 degrees C
    2030A1BMk35M: Temperature - annual min mean 11.515833 degrees C
    2030A1BMk35M: Temperature - annual range 31.769989 degrees C
    2030A1BMk35M: Temperature - coldest month min 3.11 degrees C
    2030A1BMk35M: Temperature - coolest month max 17.8 degrees C
    2030A1BMk35M: Temperature - max difference in max 3.9400024 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 3.919983 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 16.420013 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 15.471667 degrees C
    2030A1BMk35M: Temperature - min difference in max -4.7299805 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -4.6999817 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 13.880005 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 34.88 degrees C
    2030A1BMk35M: Temperature - warmest month min 19.62 degrees C
    Aridity index - annual mean 0.3459745
    Aridity index - month max 0.6992107
    Aridity index - month min 0.17858005
    Evaporation - annual mean 173.09242 (ml/5km x 5km pixel)
    Evaporation - average 14692.0 ml
    Evaporation - month max 307.98514 mm
    Evaporation - month min 60.06773 mm
    Evaporation - variability 22.0 %
    Growth index C3 macrotherm plants - annual mean 0.09 index
    Growth index C3 mesotherm plants - annual mean 0.19 index
    Growth index C4 megatherm plants - annual mean 0.07 index
    Humidity - annual mean relative 75.25071 %
    Humidity - annual mean relative 3pm 64.57126 %
    Humidity - month max relative 90.03902 %
    Humidity - month max relative 3pm 76.54582 %
    Humidity - month min relative 55.124943 %
    Humidity - month min relative 3pm 55.124943 %
    Precipitation - annual 581.0 mm
    Precipitation - annual (Bio12) 625.0 mm
    Precipitation - annual (log) seasonality index 0.06204093
    Precipitation - annual mean 48.740673 mm
    Precipitation - annual seasonality 0.40638274
    Precipitation - annual seasonality ratio 1.4080559
    Precipitation - autumn 132.0 mm
    Precipitation - autumn reliability 32.0 %
    Precipitation - coldest quarter (Bio19) 135.0 mm
    Precipitation - driest month 37.88809 mm
    Precipitation - driest period (Bio14) 8.0 mm
    Precipitation - driest quarter (Bio17) 128.0 mm
    Precipitation - equinox seasonality ratio 1.0681819
    Precipitation - max difference between successive months 0.7741935 mm/day
    Precipitation - min difference between successive months -0.57236654 mm/day
    Precipitation - seasonality (Bio15) 24.0 mm
    Precipitation - solstice seasonality ratio 1.6233754
    Precipitation - spring 140.0 mm
    Precipitation - spring or autumn (log) season 0.013389214
    Precipitation - spring or autumn season 0.067669176
    Precipitation - spring reliability 44.0 %
    Precipitation - summer 192.0 mm
    Precipitation - summer or winter (log) season 0.10055228
    Precipitation - summer or winter season 0.61817575
    Precipitation - summer reliability 33.0 %
    Precipitation - warmest quarter (Bio18) 198.0 mm
    Precipitation - wettest month 79.0 mm
    Precipitation - wettest period (Bio13) 19.0 mm
    Precipitation - wettest quarter (Bio16) 205.0 mm
    Precipitation - winter 118.0 mm
    Precipitation - winter reliability 37.0 %
    Precipitation deficit - annual mean -124.35175 mm
    Precipitation deficit - month max -252.98514 mm
    Precipitation deficit - month min -18.06773 mm
    Radiation - annual mean (Bio20) 18.4 MJ/m2/day
    Radiation - coldest quarter (Bio27) 11.3 MJ/m2/day
    Radiation - driest quarter (Bio25) 17.9 MJ/m2/day
    Radiation - highest period (Bio21) 26.1 MJ/m2/day
    Radiation - lowest period (Bio22) 9.3 MJ/m2/day
    Radiation - max month precipitation modified 26.3 MJ/m2/day
    Radiation - mean annual precipitation modified 18.525 MJ/m2/day
    Radiation - min month precipitation modified 9.6 MJ/m2/day
    Radiation - seasonality (Bio23) 32.0
    Radiation - warmest quarter (Bio26) 24.5 MJ/m2/day
    Radiation - wettest quarter (Bio24) 25.1 MJ/m2/day
    Temperature - annual max mean 24.644167 degrees C
    Temperature - annual mean (Bio01) 17.8 degrees C
    Temperature - annual min mean 9.808333 degrees C
    Temperature - annual range 29.772064 degrees C
    Temperature - annual range (Bio07) 31.7 degrees C
    Temperature - coldest month min 2.07 degrees C
    Temperature - coldest period min (Bio06) 2.0 degrees C
    Temperature - coldest quarter mean (Bio11) 10.1 degrees C
    Temperature - coolest month max 15.7 degrees C
    Temperature - diurnal range mean (Bio02) 15.2 degrees C
    Temperature - driest quarter mean (Bio09) 14.0 degrees C
    Temperature - isothermality (Bio03) 0.48 %
    Temperature - max absolute mean max 43.0 degrees C
    Temperature - max difference in max 4.0599976 degrees C/day
    Temperature - max difference in min 4.019989 degrees C/day
    Temperature - max month diurnal range 15.910004 degrees C
    Temperature - mean annual absolute mean min -3.0106428 degrees C
    Temperature - mean annual diurnal range 14.835838 degrees C
    Temperature - min absolute mean min -6.02464 degrees C
    Temperature - min difference in max -4.7700195 degrees C/day
    Temperature - min difference in min -5.0 degrees C/day
    Temperature - min month diurnal range 13.119995 degrees C
    Temperature - month hottest maximum 32.71 degrees C
    Temperature - month mean absolute max 39.206768 degrees C
    Temperature - seasonality (Bio04) 2.04
    Temperature - warmest month min 17.59 degrees C
    Temperature - warmest period max (Bio05) 33.7 degrees C
    Temperature - warmest quarter (Bio10) 25.2 degrees C
    Temperature - wettest quarter mean (Bio08) 24.6 degrees C
    Vapour pressure deficit - annual mean 0.5084509 KPa
    Vapour pressure deficit - annual mean 9am 0.7217981 KPa
    Vapour pressure deficit - month max 1.3429267 KPa
    Vapour pressure deficit - month max 9am 1.3429267 KPa
    Vapour pressure deficit - month min 0.0 KPa
    Vapour pressure deficit - month min 9am 0.2890756 KPa
    Wind run - annual mean 156.10896 km/day
    Wind run - month max 187.1891 km/day
    Wind run - month min 127.9 km/day
    Wind speed - annual mean 3pm 3.35 m/s
    Wind speed - annual mean 9am 2.8416667 m/s
    Wind speed - annual mean 9am or 3pm 3.7 m/s
    Wind speed - month max 3pm 3.9 m/s
    Wind speed - month max 9am 3.5 m/s
    Wind speed - month max 9am or 3pm 3.9 m/s
    Wind speed - month min 3pm 2.9 m/s
    Wind speed - month min 9am 2.0 m/s
    Wind speed - month min 9am or 3pm 2.0 m/s
    WorldClim: Precipitation - annual 627.0 mm
    WorldClim: Precipitation - coldest quarter 125.0 mm
    WorldClim: Precipitation - driest month 37.0 mm
    WorldClim: Precipitation - driest quarter 122.0 mm
    WorldClim: Precipitation - seasonality 27.0
    WorldClim: Precipitation - warmest quarter 212.0 mm
    WorldClim: Precipitation - wettest month 89.0 mm
    WorldClim: Precipitation - wettest quarter 212.0 mm
    WorldClim: Temperature - annual mean 177.0 degrees C * 10
    WorldClim: Temperature - annual range 304.0 degrees C * 10
    WorldClim: Temperature - coldest month min 27.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 103.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 147.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 113.0 degrees C * 10
    WorldClim: Temperature - isothermality 48.0 %
    WorldClim: Temperature - seasonality 5659.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 331.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 248.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 248.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 3.347013 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.3471311 km
    Euclidean Distance to Coast (metres) 187704.28 m
    Remoteness index 6.07
    Hydrology
    Drainage - average 95.0 megalitres/5x5km/year
    Drainage - variability 283.0 %
    Runoff - average 88.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Social
    Age 43.1 years
    Age - prime group 21.2 Count
    Disadvantaged 955.428 points (mean=1000)
    Education - degrees 7.3 %
    Education - vocational training 22.5 %
    Employment 31.6 %
    Home ownership 68.6 %
    Income - high 16.4 %
    Income - low 23.2 %
    Internet 45.5 %
    Population - change -3.0 count
    Population - density SLA 2006 p/sqkm) 0.8 people/km^2
    Unemployment rate 4.7 %
    Work force - older 28.6 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.33180758
    2030A1BMk35M: Crop factor - month max 0.5959855
    2030A1BMk35M: Crop factor - month min 0.1780376
    2030A1BMk35M: Water deficit - month max 150.03514 mm
    2030A1BMk35M: Water deficit - month mean 62.90612 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -1.4748449 MPa
    2030A1BMk35M: Water potential - month max -1.3362104 MPa
    2030A1BMk35M: Water potential - month min -1.5 MPa
    2030A1BMk35M: Water stress index - annual mean 29.862682
    2030A1BMk35M: Water stress index - month max 53.63869
    2030A1BMk35M: Water stress index - month min 16.023384
    2030A1BMk35M: Water surplus - annual mean 0.0 mm
    2030A1BMk35M: Water surplus - month max 0.0 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 150.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.1 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 23.0 %
    Bouguer gravity anomalies -195.9434 Gal
    Bulk density 1.2780808 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 0.77646035 %
    Carbon store pre-European 67.60641 kgC/ha
    Clay % 25.042929 %
    Crop factor - annual mean 0.34367356
    Crop factor - month max 0.62102866
    Crop factor - month min 0.17858005
    Erodibility 38.0 k factor
    Erosional surfaces - proportion 50.0 %
    Erosivity 1657.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 140.0 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 65.5 my
    Lithology - fertility 2.0 index
    Lithology - mean age 32.75 my
    Lithology - mean age (log) 1.5152113 log my
    Lithology - mean age range (log) 1.8162413 log my
    Magnetic anomalies -220.0 nT
    Moisture - average 42.0 %
    Moisture - variability 15.0 %
    Moisture Index - annual mean (Bio28) 0.37
    Moisture Index - coldest quarter mean (Bio35) 0.63
    Moisture Index - highest period (Bio29) 0.71
    Moisture Index - highest quarter mean (Bio32) 0.63
    Moisture Index - lowest period (Bio30) 0.18
    Moisture Index - lowest quarter mean (Bio33) 0.22
    Moisture Index - seasonality (Bio31) 46.0
    Moisture Index - warmest quarter mean (Bio34) 0.24
    Nitrogen - plant-available pre-European 5802.891 kgN/ha
    Nitrogen concentration pre-European 47.36128 mgN kg/H2O
    Nitrogen store pre-European 55.1027 kgN/ha
    Nutrient status 1.0 index
    Pedality hydrological score 0.0
    Ph - soil 6.0 ph
    Phosphorus - plant-available pre-European 10.14657 kgP/ha
    Phosphorus - plant-available total pre-European 810.2751 kgP/ha
    Phosphorus pre-European 8.721073 mgP kg/H2O
    Soil depth 1.1 m
    Soil pedality 2.0
    Soils - coarse 0.0 class
    Substrate data reliability 1.0
    Topographic wetness index 12.4434
    Unreliable water retention parameters 0.0
    Water deficit - month max 156.4366 mm
    Water deficit - month mean 66.678696 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 52000.0 mm
    Water holding capacity - plant-available 162.0 mm
    Water potential - annual mean -1.4692926 MPa
    Water potential - month max -1.2823215 MPa
    Water potential - month min -1.5 MPa
    Water stress index - annual mean 30.930618
    Water stress index - month max 55.89258
    Water stress index - month min 16.072203
    Water surplus - annual mean 0.0 mm
    Water surplus - month max 0.0 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 4.33793 Weathering Intensity Index
    Topography
    Aspect 37.0 degrees
    Averaged Topographic Relief 49.625 metres
    Bathymetry and Topography 9 sec 296.0 m
    Elevation 294.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 0.63430953 degrees
    Topographic relief 7.243988 m
    Topographic roughness 0.7235477 %
    Topographic slope (%) 0.4217601 %
    Valley bottom % 75.0 %
    Valley bottom flatness index 2.91562
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3334 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 54.0 %
    Fractional Cover - Bare Soil (2012-03-05) 29.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 20.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 51.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0162 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.1 m^2 plant / m^2 ground
    NDVI Mean 49.0 NDVI x 100
    NPP Mean 6.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.543 NDVI
    Phenology peak day of year 2012 wet 71.5 Day