Occurrence record: BOLD - Australian records - 3435116

GenomicDNA of OPHIURIDA recorded on 2009-01-01

Dataset

Data provider Barcode of Life
Data resource BOLD - Australian records
Catalogue Number 3435116
Other catalogue numbers recordID:1251933;ProcessID:OPHAN392-09;sampleID:TOH_0487
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Preparations nullnull
Collector/Observer R, T. Thresher|A, D. Staples
Supplied as "Thresher R & Staples D A"
License CC-BY-Int
Field number TN228 J2-389-001
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Tim Ohara

Event

Field number TN228 J2-389-001
Record date 2009-01-01
Date precision Day

Taxonomy

Scientific name OPHIURIDA
Taxon rank order
Kingdom Animalia
Phylum Echinodermata
Class Ophiuroidea
Order Ophiurida
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Tasmania
Locality Hill offshore of St. Helens
Latitude -41.239
Longitude 148.819
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Marine

Additional properties

genbank accession GU806212
markercode COI-5P
nucleotides -ACTCTGTATCTAGTCTTTGGAGCTTGAGCTGGGACTGTAGGAACTGCGATGAGAAAAATTATTCGAGTGGAACTTTCTCAACCGGGATCTCTCATACAGAAAGATCAAACTTATAAAGTTATAGTTACAGCCCATGCTTTTGTTATGATATTCTTTATGGTAATGCCTATAATGATAGGAGGGTTTGGAAAATGACTAGTCCCATTAATGATTGGAGCACCAGACATGGCCTTTCCACGAATGAAAAAAATGAGATTTTGATTAATCCCCCCCTCTTTTTTATTATTAATAGCATCAGCTGGTAAAGAAAGAGGTGTTGGGACAGGATGAACTGTATACCCCCCTTTATCAGGACCAGTTGCCCATGCAGGAGGCTGTGTTGATTTAGCTATTTTTTCCTTACATCTAGCTGGAGCTTCCTCAATAATGGCCTCAATAAATTTTATAACCACTATAATAAACATGCGGGCTCCCGGTATGACAATGGACCGCACCCCTCTATTTGTTTGATCAATATTAATTACTACATTTTTACTCCTATTATCACTTCCAGTACTAGCTGGAGCAATTACAATGTTACTAACAGATCGAAAAATTAACACATCATTTTTTGACCCAACTGGTGGGGGTGACCCAATCCTTTTTCAACACCTATT-
owner institution code Museum Victoria, Australia
sequence last updated 2011-11-14T08:11:47Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    First of the month Warning
    First of the year Warning
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the century Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 13 missing properties
    Show/Hide 46 tests that have not been run

    Additional political boundaries information

    Area Management
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Area management
    National Landcare Program Management Units 2018 Marine NRM
    Biodiversity
    IMCRA 4 Regions Tasmania Province
    Marine
    Contiguous Zone Contiguous Zone
    Continental Shelf Continental Shelf
    Exclusive Economic Zone Exclusive Economic Zone
    FAO Fishery Statistical Areas 57
    Geomorphology of the Australian Margin and adjacent seafloor Slope
    Global Seagrass Species Richness (2003) 4.00000000
    Marine Ecoregions of the World Bassian

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.0
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 0.0
    Endemism 0.07832623
    Endemism (Non-marine) 0.0
    Mammals – Fritz et al 2009 - 0.5 degree 0.2867
    Occurrence Density 345.0 frequency
    Shannon Diversity (H) 4.2711086 index
    Species Richness 120.0 frequency
    Distance
    Euclidean Distance to Coast (metres) 21028.043 m
    Marspec Distance to Shore 53.0 km
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    Marspec Annual Range in Sea Surface Salinity 0.24 100 x psu
    Marspec Annual Range in Sea Surface Temperature 5.74 100 x degrees C
    Marspec Annual Variance in Sea Surface Salinity 0.71 100 x psu
    Marspec Annual Variance in Sea Surface Temperature 3.968 10,000 x degrees C
    Marspec Bathymetric Slope 5.1 10 x degrees
    Marspec Concavity -0.002 1000 x degrees
    Marspec East/West Aspect 0.97999996 radians
    Marspec Maximum Monthly Sea Surface Salinity 35.469997 100 x psu
    Marspec Mean Annual Sea Surface Salinity 35.32 100 x psu
    Marspec Mean Annual Sea Surface Temperature 15.92 100 x degrees C
    Marspec Minimum Monthly Sea Surface Salinity 35.23 100 x psu
    Marspec North/South Aspect 0.21 1 x radians
    Marspec Plan Curvature -0.0063 x 10000
    Marspec Profile Curvature -0.0061 x 10000
    Marspec Sea Surface Temperature of the coldest ice-free month 13.429999 100 x degrees C
    Marspec Sea Surface Temperature of the warmest ice-free month 19.17 100 x degrees C
    Sea Surface Temperature - MODIS Terra 16.122787 Degrees C
    SeaWIFS K490 Mean 0.06345572 Kd@490nm/m^2
    SeaWiFS Chlorophyll Mean 0.38333306 mg/m^3
    Topography
    Averaged Topographic Relief 767.1667 metres
    Bathymetry and Elvation 9 sec -1419.0 m
    Topographic Slope (degrees) 11.418595 degrees