Occurrence record:

EnvironmentalDNA of Pleosporaceae recorded on 2016-09-01

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated sequences https://www.ncbi.nlm.nih.gov/biosample/SAMN07449144
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2016-09-01
Date precision Day

Taxonomy

Scientific name Pleosporaceae
Taxon rank family
Kingdom Fungi
Phylum Ascomycota
Class Dothideomycetes
Order Pleosporales
Family Pleosporaceae
Genus Pleosporaceae unclassified
Species Pleosporaceae unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province South Australia
Locality Playford (C)
Locality City of Playford
Latitude -34.716414
Longitude 138.678811
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 46.0

Additional properties

ammonium nitrogen mg kg 2.0
amplicon ITS1FITS4_fungi
boron hot cacl2 mg kg 1.45
clay 17.22
color BRGR
conductivity dsm ds m 0.068
course sand 21.0
depth m 0.0
detailed land use Intensive Uses - Residential and farm infrastructure - Urban residential
dtpa copper mg kg 1.45
dtpa iron mg kg 37.9
dtpa manganese mg kg 34.0
dtpa zinc mg kg 1.27
environment Soil
exc aluminium meq 100g 0.083
exc calcium meq 100g 5.26
exc magnesium meq 100g 2.14
exc potassium meq 100g 1.07
exc sodium meq 100g 0.5
fine sand 47.56
general ecological zone Temperate
gravel 5.0
ncbi bioproject accession PRJNA317932
ncbi biosample accession SAMN07449144
nitrate nitrogen mg kg 1.0
otu CACAATATGAAGGCGGGGAGCGTGGTCCTCCTCAAGAGTGACCTGCCCTGCTGAATTATTCACCCGTGTCTTTTGCGTACTTCTTGTTTCCTGGGTGGGCTCGCCCACCACCAGGACCAACCAATAAACCTTTTGTAATTGCAATCAGCGTCAGTAACAATGTAATAATTA
otucount 944
organic carbon 1.18
ph level cacl2 cacl2 5.9
ph level h2o h2o 6.9
phosphorus colwell mg kg 8.0
potassium colwell mg kg 482.0
sample id 102.100.100/39129
sample type Soil
sand 68.56
silt 14.22
sulphur mg kg 8.5
texture 3.5
vegetation type Woodland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Habitat incorrect for species Failed
    First of the month Warning
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the year Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 43 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Southern Australia Mallee and Woodlands
    Irrigation practice - dominant No irrigation
    Land use Urban intensive uses
    NRM Regions 2010 Adelaide and Mount Lofty Ranges
    NRM Regions 2014 Adelaide and Mount Lofty Ranges
    NRM Regions 2015 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 Adelaide and Mount Lofty Ranges
    NRM Regions 2017 (Qld 2019) Adelaide and Mount Lofty Ranges
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Adelaide and Mount Lofty Ranges
    Biodiversity
    Freshwater Ecoregions of the World Murray - Darling
    IBRA 6 Regions Flinders Lofty Block
    IBRA 6 Sub Regions Mount Lofty Ranges
    IBRA 7 Regions Flinders Lofty Block
    IBRA 7 Subregions Mount Lofty Ranges
    Terrestrial Ecoregional Boundaries Tirari-Sturt Stony Desert
    World Anthropogenic Biomes (2000) Urban
    Climate
    Agroclimatic classification of Australia "Mediterranean" climate, but with drier cooler winters and less growth than Classic "Mediterranean" climate
    Koppen Climate Classification (All Classes) Temperate: distinctly dry (and hot) summer
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Pasture, cropland (temperate)
    Hydrology
    Drainage Divisions Level 1 South Australian Gulf
    Drainage Divisions Level 2 GAWLER RIVER
    River Regions GAWLER RIVER
    Marine
    Marine Ecoregions of the World South Australian Gulfs
    States including coastal waters South Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories South Australia
    Australian States and Territories South Australia
    Commonwealth Electoral Boundaries Wakefield
    Local Government Areas 2011 Playford (C)
    Local Government Areas 2012 deprecated Playford - Elizabeth
    Local Government Areas PSMA 2018 CITY OF PLAYFORD
    Native Title Determinations (13/7/2020) Kaurna Peoples Native Title Claim SCD2018/001
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 84
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 3092
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER ADELAIDE
    PSMA ABS SA2 Statistical Areas (2016) ELIZABETH EAST
    PSMA ABS SA3 Statistical Areas (2016) PLAYFORD
    PSMA ABS SA4 Statistical Areas (2016) ADELAIDE - NORTH
    PSMA Commonwealth Electoral Boundaries (2016) WAKEFIELD
    PSMA Commonwealth Electoral Boundaries (2018) SPENCE
    PSMA Indigenous Areas (2016) PLAYFORD
    PSMA Indigenous Locations (2016) PLAYFORD - ELIZABETH
    PSMA Indigenous Regions (2016) ADELAIDE
    PSMA Localities (2018) MUNNO PARA
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) MAJOR URBAN
    PSMA Section of State Range (2016) 1 MILLION OR MORE
    PSMA Significant Urban Area (2016) ADELAIDE
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) SOUTH AUSTRALIA
    PSMA Urban Centre and Locality (2016) ADELAIDE
    PSMA Wards (2018) WARD 4
    Statistical Local Areas Playford (C) - Elizabeth
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia St Vincent Region
    Surface Geology of Australia Qrc
    Topography
    Physiographic Provinces of Australia Gulfs Ranges Province
    Physiographic Regions 2011 Torrens-Gulf Plains
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Built-up
    NVIS 4.1 Major Vegetation Groups Cleared, non-native vegetation, buildings
    NVIS 4.1 Major Vegetation Subgroups Cleared, non-native vegetation, buildings
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Removed
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present cleared, non-native vegetation, buildings

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 7775071.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.7548
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 3.1378
    Endemism 0.017485311
    Endemism (Non-marine) 0.019491833
    Mammals – Fritz et al 2009 - 0.5 degree 0.5124
    Migratory species (2008) 3.0 frequency
    Occurrence Density 49195.0 frequency
    Shannon Diversity (H) 5.359312 index
    Species Richness 1784.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 6.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.3747082
    2030A1BMk35M: Evaporation - month min 53.72 mm
    2030A1BMk35M: Precipitation - annual mean 34.708332 mm
    2030A1BMk35M: Precipitation - driest month 12.5 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.273376
    2030A1BMk35M: Precipitation - spring or autumn season 0.27045247
    2030A1BMk35M: Temperature - annual max mean 23.65 degrees C
    2030A1BMk35M: Temperature - annual min mean 12.066667 degrees C
    2030A1BMk35M: Temperature - annual range 24.269989 degrees C
    Aridity index - annual mean 0.45244706
    Aridity index - month max 1.120743
    Aridity index - month min 0.076260105
    Evaporation - annual mean 142.9264 (ml/5km x 5km pixel)
    Evaporation - average 11399.0 ml
    Evaporation - month max 262.6583 mm
    Evaporation - month min 49.99393 mm
    Evaporation - variability 12.0 %
    Growth index C3 macrotherm plants - annual mean 0.05 index
    Growth index C3 mesotherm plants - annual mean 0.23 index
    Growth index C4 megatherm plants - annual mean 0.03 index
    Humidity - annual mean relative 75.11114 %
    Humidity - annual mean relative 3pm 64.92866 %
    Humidity - month max relative 89.63225 %
    Humidity - month max relative 3pm 78.39836 %
    Humidity - month min relative 52.154663 %
    Humidity - month min relative 3pm 52.154663 %
    Precipitation - annual 453.0 mm
    Precipitation - annual (Bio12) 472.0 mm
    Precipitation - annual mean 39.708252 mm
    Precipitation - annual seasonality -0.9839694
    Precipitation - coldest quarter (Bio19) 184.0 mm
    Precipitation - driest month 20.0 mm
    Precipitation - driest period (Bio14) 3.0 mm
    Precipitation - driest quarter (Bio17) 56.0 mm
    Precipitation - equinox seasonality ratio 1.0636089
    Precipitation - seasonality (Bio15) 44.0 mm
    Precipitation - spring or autumn season 0.06306064
    Precipitation - warmest quarter (Bio18) 56.0 mm
    Precipitation - wettest month 60.03035 mm
    Precipitation - wettest period (Bio13) 16.0 mm
    Precipitation - wettest quarter (Bio16) 184.0 mm
    Radiation - annual mean (Bio20) 17.6 MJ/m2/day
    Radiation - seasonality (Bio23) 41.0
    Radiation - warmest quarter (Bio26) 25.8 MJ/m2/day
    Temperature - annual max mean 21.8325 degrees C
    Temperature - annual mean (Bio01) 16.9 degrees C
    Temperature - annual min mean 10.8324995 degrees C
    Temperature - annual range 23.0 degrees C
    Temperature - annual range (Bio07) 24.5 degrees C
    Temperature - coldest month min 6.25 degrees C
    Temperature - coldest period min (Bio06) 6.2 degrees C
    Temperature - coldest quarter mean (Bio11) 11.4 degrees C
    Temperature - diurnal range mean (Bio02) 11.4 degrees C
    Temperature - driest quarter mean (Bio09) 22.6 degrees C
    Temperature - isothermality (Bio03) 0.46 %
    Temperature - month hottest maximum 28.98 degrees C
    Temperature - seasonality (Bio04) 1.52
    Temperature - warmest month min 15.73 degrees C
    Temperature - warmest period max (Bio05) 30.7 degrees C
    Temperature - warmest quarter (Bio10) 22.6 degrees C
    Temperature - wettest quarter mean (Bio08) 11.4 degrees C
    Wind run - annual mean 264.9137 km/day
    WorldClim: Precipitation - annual 481.0 mm
    WorldClim: Precipitation - coldest quarter 179.0 mm
    WorldClim: Precipitation - driest month 16.0 mm
    WorldClim: Precipitation - driest quarter 55.0 mm
    WorldClim: Precipitation - seasonality 42.0
    WorldClim: Precipitation - warmest quarter 58.0 mm
    WorldClim: Precipitation - wettest month 62.0 mm
    WorldClim: Precipitation - wettest quarter 180.0 mm
    WorldClim: Temperature - annual mean 164.0 degrees C * 10
    WorldClim: Temperature - annual range 233.0 degrees C * 10
    WorldClim: Temperature - coldest month min 62.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 110.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 113.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 217.0 degrees C * 10
    WorldClim: Temperature - isothermality 48.0 %
    WorldClim: Temperature - seasonality 4241.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 295.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 219.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 119.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.1456022 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.10198039 km
    Euclidean Distance to Coast (metres) 12901.868 m
    Remoteness index 0.0
    Hydrology
    Drainage - average 196.0 megalitres/5x5km/year
    Drainage - variability 124.0 %
    Runoff - average 28.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Substrate
    2030A1BMk35M: Water stress index - month max 80.99999
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 45.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.63 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 30.0 %
    Bulk density 1.5384234 Mg/m^3
    Carbon - organic 0.86866426 %
    Clay % 50.61036 %
    Hydrologic conductivity - average saturated 13.333333 mm/h
    Moisture Index - annual mean (Bio28) 0.41
    Moisture Index - highest quarter mean (Bio32) 0.84
    Nutrient status 2.0 index
    Ph - soil 7.0 ph
    Soil depth 1.2 m
    Soil pedality 3.8342342
    Water holding capacity 24000.0 mm
    Water stress index - month max 80.99999
    Weathering Intensity V2 5.1769 Weathering Intensity Index
    Topography
    Aspect 272.0 degrees
    Averaged Topographic Relief 147.5 metres
    Bathymetry and Topography 9 sec 45.0 m
    Elevation 43.0 m
    Topographic Slope (degrees) 0.63120884 degrees
    Topographic relief 10.611 m
    Topographic slope (%) 0.7478768 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.2632 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 21.0 %
    Fractional Cover - Bare Soil (2012-03-05) 41.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 31.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 29.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0073 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.3 m^2 plant / m^2 ground
    NDVI Mean 42.0 NDVI x 100
    NPP Mean 4.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.4519 NDVI