We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3525131

GenomicDNA of LEPIDOPTERA | Moths recorded on 1998-03-01

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3525131
Other catalog numbers recordID:1382811;ProcessID:ANICC525-10;sampleID:ANIC Gen No. 003687
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Edwards, E.D.
Supplied as "E.D. Edwards"
Life stage adult
License CC-BY-Int
Field number ANIC Gen No. 003687
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Michael Shaffer

Event

Field number ANIC Gen No. 003687
Occurrence date 1998-03-01
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Queensland
Locality Tablelands (R)
Locality 5km NW by N of Tully Falls
Latitude -17.45
Longitude 145.32
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HQ546637
markercode COI-5P
nucleotides CACATTATACTTTATTTTTGGAATCTGATCTGGTATGGTAGGAACTTCACTTAGATTATTAATTCGAGCTGAATTAGGTAATCCTGGATCTTTAATCGGTAATGATCAAATCTACAATACAATTGTAACAGGTCATGCTTTTATTATAATTTTCTTCATGGTTATACCTATTATAATTGGAGGATTTGGTAATTGATTAGTACCTTTAATATTGGGGGCACCAGATATAGCTTTCCCCCGTATAAATAATATAAGATTTTGGTTATTACCCCCATCTTTAACTTTATTAATTTCAAGTAGAATTGTGGAAAATGGAGCAGGAACTGGATGAACGGTTTACCCCCCCCTTTCATCTAATATTGCCCATAGCGGAAGATCTGTAGATTTAGCTATTTTTTCCCTTCATTTAGCTGGAATTTCCTCTATTTTAGGAGCTATTAATTTTATTACTACAATTATTAATATAAAATTAAATGGTTTATTTTTTGATCAAATACCTTTATTTGTTTGATCAGTGGGAATTACTGCTCTTTTATTATTATTATCTTTACCTGTGTTAGCTGGGGCTATTACTATACTACTTACAGACCGAAATTTAAATACATCTTTTTTTGACCCAGCTGGGGGAGGAGATCCTATTTTATACCAACATTTATTT
Owner institution code Australian National Insect Collection
sequence last updated 2011-11-14T08:11:42Z

User flagged issues 

    Data quality tests

    Test name Result
    First of the month Warning
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the year Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 46 tests that have not been run

    Additional political boundaries information

    Area Management
    Australian Tropical Savanna Australian Tropical Savanna
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Northern Australia and Trans-Fly Savannas
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant 6. Local knowledge
    Land use Grazing of native pastures
    NRM Regions 2010 Wet Tropics
    NRM Regions 2014 Wet Tropics
    NRM Regions 2015 Wet Tropics
    NRM Regions 2017 Wet Tropics
    NRM Regions 2017 (Qld 2019) Wet Tropics
    Stubble practice - dominant (area) Stubble removed
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 Wet Tropics
    Biodiversity
    Freshwater Ecoregions of the World Arafura - Carpentaria
    IBRA 6 Regions Einasleigh Uplands
    IBRA 6 Sub Regions Herberton - Wairuna
    IBRA 7 Regions Einasleigh Uplands
    IBRA 7 Subregions Herberton-Wairuna
    Terrestrial Ecoregional Boundaries Einasleigh Upland Savanna
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Strongly developed wet and dry seasons with cooler winter and with a growing season lasting at least six months
    Koppen Climate Classification (All Classes) Subtropical: distinctly dry winter
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Eucalypt savanna woodland (monsoon tropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 HERBERT RIVER
    River Regions HERBERT RIVER
    Marine
    Marine Ecoregions of the World Central and Southern Great Barrier Reef
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Kennedy
    Indigenous Land Use Agreements Joint Bar-Barrum Jirrbal Herberton Project ILUA
    Local Government Areas 2011 Tablelands (R)
    Local Government Areas 2012 deprecated Herberton
    Local Government Areas PSMA 2018 TABLELANDS REGIONAL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 30
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 653
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) HERBERTON
    PSMA ABS SA3 Statistical Areas (2016) TABLELANDS (EAST) - KURANDA
    PSMA ABS SA4 Statistical Areas (2016) CAIRNS
    PSMA Commonwealth Electoral Boundaries (2016) KENNEDY
    PSMA Commonwealth Electoral Boundaries (2018) KENNEDY
    PSMA Indigenous Areas (2016) HERBERTON - RAVENSHOE
    PSMA Indigenous Locations (2016) HERBERTON TABLELANDS
    PSMA Indigenous Regions (2016) CAIRNS - ATHERTON
    PSMA Localities (2018) SILVER VALLEY
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) DALRYMPLE
    PSMA State Electoral Boundaries (2018) HILL
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Tablelands (R) - Herberton
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Cairns Region
    Surface Geology of Australia Cflg
    Topography
    Physiographic Provinces of Australia Peninsular Uplands Province
    Physiographic Regions 2011 Atherton Tableland
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Other special rights, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    IGBP Land Cover vegetation classification scheme (2011) Woody savannas
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus woodlands with a tussock grass understorey
    Tenure of Australia's forests (2013) v2.0 Leasehold
    Vegetation - condition Modified
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 4148781.0 $
    Area management
    Phosphorus 0.03025 t/ha
    Potassium 0.092425 t/ha
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.9249
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.9561
    Endemism 0.02136497
    Endemism (Non-marine) 0.022001173
    Mammals – Fritz et al 2009 - 0.5 degree 0.5794
    Migratory species (2008) 6.0 frequency
    Occurrence Density 4483.0 frequency
    Shannon Diversity (H) 5.6674943 index
    Species Richness 735.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 16.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.5384401
    2030A1BMk35M: Evaporation - month min 93.21 mm
    2030A1BMk35M: Precipitation - annual mean 78.67 mm
    2030A1BMk35M: Precipitation - driest month 10.89 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.43044925
    2030A1BMk35M: Precipitation - spring or autumn season -1.3102063
    2030A1BMk35M: Temperature - annual max mean 26.758333 degrees C
    2030A1BMk35M: Temperature - annual min mean 15.71 degrees C
    2030A1BMk35M: Temperature - annual range 19.73999 degrees C
    Aridity index - annual mean 0.69666165
    Aridity index - month max 2.0566223
    Aridity index - month min 0.11133545
    Evaporation - annual mean 126.21799 (ml/5km x 5km pixel)
    Evaporation - average 19258.0 ml
    Evaporation - month max 175.83626 mm
    Evaporation - month min 80.34335 mm
    Evaporation - variability 18.0 %
    Growth index C3 macrotherm plants - annual mean 0.35 index
    Growth index C3 mesotherm plants - annual mean 0.55 index
    Growth index C4 megatherm plants - annual mean 0.26 index
    Humidity - annual mean relative 81.936935 %
    Humidity - annual mean relative 3pm 68.412575 %
    Humidity - month max relative 89.018974 %
    Humidity - month max relative 3pm 74.725845 %
    Humidity - month min relative 59.20425 %
    Humidity - month min relative 3pm 59.20425 %
    Precipitation - annual 1076.0 mm
    Precipitation - annual (Bio12) 1000.0 mm
    Precipitation - annual mean 89.2635 mm
    Precipitation - annual seasonality 4.0074883
    Precipitation - coldest quarter (Bio19) 54.0 mm
    Precipitation - driest month 15.21246 mm
    Precipitation - driest period (Bio14) 2.0 mm
    Precipitation - driest quarter (Bio17) 42.0 mm
    Precipitation - equinox seasonality ratio 0.40322986
    Precipitation - seasonality (Bio15) 93.0 mm
    Precipitation - spring or autumn season -1.4678178
    Precipitation - warmest quarter (Bio18) 526.0 mm
    Precipitation - wettest month 239.0 mm
    Precipitation - wettest period (Bio13) 60.0 mm
    Precipitation - wettest quarter (Bio16) 598.0 mm
    Radiation - annual mean (Bio20) 19.8 MJ/m2/day
    Radiation - seasonality (Bio23) 17.0
    Radiation - warmest quarter (Bio26) 22.4 MJ/m2/day
    Temperature - annual max mean 25.075 degrees C
    Temperature - annual mean (Bio01) 20.4 degrees C
    Temperature - annual min mean 14.221666 degrees C
    Temperature - annual range 18.921265 degrees C
    Temperature - annual range (Bio07) 19.8 degrees C
    Temperature - coldest month min 9.42 degrees C
    Temperature - coldest period min (Bio06) 9.8 degrees C
    Temperature - coldest quarter mean (Bio11) 16.2 degrees C
    Temperature - diurnal range mean (Bio02) 11.0 degrees C
    Temperature - driest quarter mean (Bio09) 17.1 degrees C
    Temperature - isothermality (Bio03) 0.55 %
    Temperature - month hottest maximum 28.75 degrees C
    Temperature - seasonality (Bio04) 1.01
    Temperature - warmest month min 18.22 degrees C
    Temperature - warmest period max (Bio05) 29.7 degrees C
    Temperature - warmest quarter (Bio10) 23.7 degrees C
    Temperature - wettest quarter mean (Bio08) 23.4 degrees C
    Wind run - annual mean 137.11293 km/day
    WorldClim: Precipitation - annual 1110.0 mm
    WorldClim: Precipitation - coldest quarter 63.0 mm
    WorldClim: Precipitation - driest month 16.0 mm
    WorldClim: Precipitation - driest quarter 48.0 mm
    WorldClim: Precipitation - seasonality 89.0
    WorldClim: Precipitation - warmest quarter 595.0 mm
    WorldClim: Precipitation - wettest month 233.0 mm
    WorldClim: Precipitation - wettest quarter 673.0 mm
    WorldClim: Temperature - annual mean 203.0 degrees C * 10
    WorldClim: Temperature - annual range 195.0 degrees C * 10
    WorldClim: Temperature - coldest month min 98.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 163.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 112.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 171.0 degrees C * 10
    WorldClim: Temperature - isothermality 57.0 %
    WorldClim: Temperature - seasonality 2796.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 293.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 233.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 229.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.01 degrees
    Distance - to coast 0.6957011 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.01 km
    Euclidean Distance to Coast (metres) 64350.203 m
    Remoteness index 4.9652343
    Hydrology
    Drainage - average 322.0 megalitres/5x5km/year
    Drainage - variability 167.0 %
    Runoff - average 2505.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 844.74 m
    Social
    Population - density SLA 2006 p/sqkm) 0.6 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 25.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.67 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 28.0 %
    Bulk density 1.0842 Mg/m^3
    Carbon - organic 0.9175862 %
    Clay % 24.6 %
    Hydrologic conductivity - average saturated 61.11111 mm/h
    Moisture Index - annual mean (Bio28) 0.62
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.3 index
    Ph - soil 5.0 ph
    Soil depth 0.6 m
    Soil pedality 1.754
    Water holding capacity 60000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 2.37182 Weathering Intensity Index
    Topography
    Aspect 158.0 degrees
    Averaged Topographic Relief 294.58334 metres
    Bathymetry and Elvation 9 sec 840.0 m
    Elevation 852.0 m
    Topographic Slope (degrees) 6.093843 degrees
    Topographic relief 33.84131 m
    Topographic slope (%) 1.910717 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.6857 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 34.0 %
    Gross Primary Productivity (2012-03-13) 0.0047 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 0.7 m^2 plant / m^2 ground
    NDVI Mean 51.0 NDVI x 100
    NPP Mean 10.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7824 NDVI