Occurrence record:

EnvironmentalDNA of Helotiales recorded on 2013-07-17

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2013-07-17
Date precision Day

Taxonomy

Scientific name Helotiales
Taxon rank order
Kingdom Fungi
Phylum Ascomycota
Class Leotiomycetes
Order Helotiales
Family Helotiales unclassified
Genus Helotiales unclassified
Species Helotiales unclassified
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State / Province Tasmania
Locality Glamorgan/Spring Bay (M)
Locality Freycinet NP
Latitude -42.0585
Longitude 148.3002
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 4.0

Additional properties

ammonium nitrogen mg kg 1e-10
amplicon ITS1FITS4_fungi
australian soil classification Dermosols
boron hot cacl2 mg kg 1e-10
broad land use Conservation and Natural Environments
clay 1.9
color WH
conductivity dsm ds m 0.015
course sand 96.62
depth m 0.0
detailed land use Conservation and Natural Environments - Nature conservation - National park
dtpa copper mg kg 0.11
dtpa iron mg kg 1e-10
dtpa manganese mg kg 0.13
dtpa zinc mg kg 0.6
environment Soil
exc aluminium meq 100g 0.002
exc calcium meq 100g 0.3
exc magnesium meq 100g 0.05
exc potassium meq 100g 0.05
exc sodium meq 100g 0.04
fine sand 1.48
general ecological zone Coastal
gravel 0.0
nitrate nitrogen mg kg 1e-10
otu CAGAGTTCATGCCCTTCGGGGTAGACCTCCCACCCTTGTGTAATTATTACCTTTGTTGCTTTGGCGGGCCGCACGCTGTGCCTCGGGCCTTTGGGCCTGGGAGCGCCCGCCAGAGGAAACCCAAACTCTTTATGTTAGTGTCGTCTGAGTACTATATCAATAGTTA
otucount 3
organic carbon 1e-10
ph level cacl2 cacl2 6.0
ph level h2o h2o 7.0
phosphorus colwell mg kg 1e-10
potassium colwell mg kg 20.0
sample id 102.100.100/12436
sample type Soil
sand 98.1
silt 1e-10
slope 0.0
soil moisture 3.46464167062173
sulphur mg kg 1.7
texture 1.0
vegetation type Dune
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Show/Hide 12 missing properties
    Show/Hide 45 tests that have not been run

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Freycinet
    CAPAD 2012 Terrestrial Freycinet
    CAPAD 2014 Terrestrial Freycinet
    CAPAD 2016 Terrestrial Freycinet
    Fallow practice - dominant (area) Fallow less than 3 months
    Fallow practice - dominant (number) Fallow less than 3 months
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Marine Southern Australian Marine
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Irrigation practice - dominant 6. Local knowledge
    Land use Plantations
    NRM Regions 2010 South
    NRM Regions 2014 South
    NRM Regions 2015 South
    NRM Regions 2017 South NRM Region
    NRM Regions 2017 (Qld 2019) South NRM Region
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) 1-2 cultivations
    Tillage practice - dominant (number) 1-2 cultivations
    Area management
    National Landcare Program Management Units 2018 South NRM Region
    Biodiversity
    Freshwater Ecoregions of the World Southern Tasmania
    IBRA 6 Regions Tasmanian South East
    IBRA 6 Sub Regions South East
    IBRA 7 Regions Tasmanian South East
    IBRA 7 Subregions South East
    Terrestrial Ecoregional Boundaries Tasmanian Temperate Forests
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia Moisture availability high in winter-spring, moderate in summer, most plant growth in spring
    Hydrology
    Drainage Divisions Level 1 Tasmania
    Drainage Divisions Level 2 EAST COAST
    River Regions EAST COAST
    Marine
    Global Seagrass Species Richness (2003) 3.00000000
    Marine Ecoregions of the World Bassian
    States including coastal waters Tasmania (including Coastal Waters)
    Political
    ASGS Australian States and Territories Tasmania
    Australian States and Territories Tasmania
    Commonwealth Electoral Boundaries Lyons
    Local Government Areas 2011 Glamorgan/Spring Bay (M)
    Local Government Areas 2012 deprecated Glamorgan-Spring Bay
    Local Government Areas PSMA 2018 GLAMORGAN-SPRING BAY COUNCIL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 0
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 931
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF TAS.
    PSMA ABS SA2 Statistical Areas (2016) TRIABUNNA - BICHENO
    PSMA ABS SA3 Statistical Areas (2016) SOUTH EAST COAST
    PSMA ABS SA4 Statistical Areas (2016) SOUTH EAST
    PSMA Commonwealth Electoral Boundaries (2016) LYONS
    PSMA Commonwealth Electoral Boundaries (2018) LYONS
    PSMA Indigenous Areas (2016) TASMANIA - SOUTH-EAST COAST
    PSMA Indigenous Locations (2016) GLAMORGAN - SPRING DAY
    PSMA Indigenous Regions (2016) TASMANIA
    PSMA Localities (2018) COLES BAY
    PSMA Remoteness Areas (2016) Remote Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (TAS.)
    PSMA State Electoral Boundaries (2016) LYONS
    PSMA State Electoral Boundaries (2018) PROSSER
    PSMA States (2016) TASMANIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (TAS.)
    Statistical Local Areas Glamorgan/Spring Bay (M)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Northeast Tasmania Region
    Surface Geology of Australia Psp
    Topography
    Physiographic Provinces of Australia Tasmanian Uplands Province
    Physiographic Regions 2011 East Tasmanian Hills
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Eucalypt Medium Woodland
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Naturally bare - sand, rock, claypan, mudflat
    NVIS 4.1 Major Vegetation Subgroups Naturally bare, sand, rock, claypan, mudflat
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Residual
    Vegetation types - native Low closed forests and closed shrublands
    Vegetation types - present Low closed forest and tall closed shrubland

    Environmental sampling for this location

    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.6966
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.7782
    Endemism 0.013290713
    Endemism (Non-marine) 0.016388386
    Mammals – Fritz et al 2009 - 0.5 degree 0.2867
    Occurrence Density 5613.0 frequency
    Shannon Diversity (H) 4.8611817 index
    Species Richness 780.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.76285607
    2030A1BMk35M: Evaporation - month min 34.370834 mm
    2030A1BMk35M: Precipitation - annual mean 52.642082 mm
    2030A1BMk35M: Precipitation - driest month 36.76 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 1.0131111
    2030A1BMk35M: Precipitation - spring or autumn season 0.013024953
    2030A1BMk35M: Temperature - annual max mean 18.419582 degrees C
    2030A1BMk35M: Temperature - annual min mean 9.318958 degrees C
    2030A1BMk35M: Temperature - annual range 17.136658 degrees C
    Precipitation - annual (Bio12) 673.6 mm
    Precipitation - coldest quarter (Bio19) 159.8 mm
    Precipitation - driest period (Bio14) 9.4 mm
    Precipitation - driest quarter (Bio17) 146.6 mm
    Precipitation - seasonality (Bio15) 17.2 mm
    Precipitation - warmest quarter (Bio18) 177.4 mm
    Precipitation - wettest period (Bio13) 19.0 mm
    Precipitation - wettest quarter (Bio16) 207.4 mm
    Radiation - annual mean (Bio20) 13.8 MJ/m2/day
    Radiation - seasonality (Bio23) 46.0
    Radiation - warmest quarter (Bio26) 20.3 MJ/m2/day
    Temperature - annual mean (Bio01) 13.12 degrees C
    Temperature - annual range (Bio07) 17.08 degrees C
    Temperature - coldest period min (Bio06) 4.78 degrees C
    Temperature - coldest quarter mean (Bio11) 9.58 degrees C
    Temperature - diurnal range mean (Bio02) 8.98 degrees C
    Temperature - driest quarter mean (Bio09) 10.82 degrees C
    Temperature - isothermality (Bio03) 0.53 %
    Temperature - seasonality (Bio04) 0.968
    Temperature - warmest period max (Bio05) 21.88 degrees C
    Temperature - warmest quarter (Bio10) 16.66 degrees C
    Temperature - wettest quarter mean (Bio08) 15.5 degrees C
    Wind run - annual mean 142.9979 km/day
    WorldClim: Precipitation - annual 715.0 mm
    WorldClim: Precipitation - coldest quarter 187.0 mm
    WorldClim: Precipitation - driest month 48.0 mm
    WorldClim: Precipitation - driest quarter 153.0 mm
    WorldClim: Precipitation - seasonality 15.0
    WorldClim: Precipitation - warmest quarter 153.0 mm
    WorldClim: Precipitation - wettest month 80.0 mm
    WorldClim: Precipitation - wettest quarter 197.0 mm
    WorldClim: Temperature - annual mean 130.0 degrees C * 10
    WorldClim: Temperature - annual range 169.0 degrees C * 10
    WorldClim: Temperature - coldest month min 47.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 94.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 93.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 164.0 degrees C * 10
    WorldClim: Temperature - isothermality 55.0 %
    WorldClim: Temperature - seasonality 2712.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 216.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 164.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 139.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.01 degrees
    Distance - to coast 0.01 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.01 km
    Euclidean Distance to Coast (metres) 2034.544 m
    Hydrology
    Water Observations From Space 0.0 Percentage
    Marine
    GEOMACS - geometric mean 0.068805 Pascals
    Sea Surface Temperature - MODIS Terra 14.280159 Degrees C
    Substrate
    2030A1BMk35M: Water stress index - month max 80.99999
    Bulk density 1.4598603 Mg/m^3
    Clay % 20.046926 %
    Hydrologic conductivity - average saturated 157.76785 mm/h
    Moisture Index - annual mean (Bio28) 0.688
    Moisture Index - highest quarter mean (Bio32) 0.938
    Nutrient status 1.1 index
    Soil depth 0.66 m
    Soil pedality 2.3284917
    Water holding capacity 61500.0 mm
    Weathering Intensity V2 2.66751 Weathering Intensity Index
    Topography
    Averaged Topographic Relief 230.83333 metres
    Bathymetry and Topography 9 sec 9.0 m
    Topographic Slope (degrees) 1.9653385 degrees
    Topographic relief 110.8714 m
    Topographic slope (%) 9.861914 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3032 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 79.0 %
    Fractional Cover - Bare Soil (2012-03-05) 14.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 38.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 48.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0561 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 3.3 m^2 plant / m^2 ground
    Normalized Difference Vegetation Index (2012-03-05) 0.5938 NDVI