Occurrence record:

EnvironmentalDNA of Clathrus ruber recorded on 2013-08-07

Dataset

Data resource Biome of Australia Soil Environments
Basis of record EnvironmentalDNA
Supplied basis "environmentalDNA"
License CC-BY 4.0 (Int)
Associated references Bissett, A., Fitzgerald, A., Meintjes, T., Mele, P., Reith, F., & Dennis, P. et al. (2016). Introducing BASE: the Biomes of Australian Soil Environments soil microbial diversity database. Gigascience, 5(1), https://doi.org/10.1186/s13742-016-0126-5
Occurrence status present
Abcd identification qualifier Not provided

Event

Record date 2013-08-07
Date precision Day

Taxonomy

Scientific name Clathrus ruber
Taxon rank species
Kingdom Fungi
Phylum Basidiomycota
Class Agaricomycetes
Order Phallales
Family Phallaceae
Genus Clathrus
Species Clathrus ruber
Taxonomic issues No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory Western Australia
Local government area Dandaragan (S)
Locality Mt Lesueur NP
Latitude -30.1410666666667
Longitude 115.08955
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial
Verbatim elevation 49.0

Additional properties

ammonium nitrogen mg kg 2.0
amplicon ITS1FITS4_fungi
australian soil classification Tenosols
boron hot cacl2 mg kg 0.17
broad land use Conservation and Natural Environments
clay 3.93
color GRBR
conductivity dsm ds m 0.025
course sand 84.26
depth m 20.0
detailed land use Conservation and Natural Environments - Nature conservation - National park
dtpa copper mg kg 0.23
dtpa iron mg kg 9.8
dtpa manganese mg kg 5.15
dtpa zinc mg kg 0.38
environment Soil
exc aluminium meq 100g 0.033
exc calcium meq 100g 2.43
exc magnesium meq 100g 0.32
exc potassium meq 100g 0.1
exc sodium meq 100g 0.04
fine sand 9.81
general ecological zone Temperate
gravel 0.0
nitrate nitrogen mg kg 3.0
otu CCGAATGATACGCATTCATCCGTCCACACCTGTGCACTCTGGCGTGAGGGGAGACCCTCCCGCGTCTAATAAAGACGCCTGTCGTACGCATGAGATTGAGAAAAATTGTCATAAAAGACA
otucount 26
organic carbon 0.71
ph level cacl2 cacl2 5.3
ph level h2o h2o 6.3
phosphorus colwell mg kg 1e-10
potassium colwell mg kg 41.0
sample id 102.100.100/8098
sample type Soil
sand 94.07
silt 1.99
slope 2.0
soil moisture 5.85375734251569
sulphur mg kg 5.4
texture 1.5
vegetation type Shrubland
occurence status Present

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Data are generalised Passed
    Missing taxonomic rank Passed
    Name not supplied Passed
    Kingdom not recognised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Altitude out of range Passed
    Altitude value non-numeric Passed
    Altitude value supplied in feet Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Habitat incorrect for species Passed
    Show/Hide 12 missing properties
    Show/Hide 44 tests that have not been run

    Outlier information  

    This record has been detected as an outlier using the Reverse Jackknife algorithm for the following layers:

    More information on the data quality work being undertaken by the Atlas is available here:

    Additional political boundaries information

    Area Management
    CAPAD 2010 Terrestrial Lesueur
    CAPAD 2012 Terrestrial Lesueur
    CAPAD 2014 Terrestrial Lesueur
    CAPAD 2016 Terrestrial Lesueur
    Fallow practice - dominant (area) Fallow greater than 9 months
    Fallow practice - dominant (number) Fallow 3-9 months
    Global 200 priority ecoregions - Terrestrial Southwestern Australia Forests and Scrub
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 Northern Agricultural
    NRM Regions 2014 Northern Agricultural
    NRM Regions 2015 Northern Agricultural
    NRM Regions 2017 Northern Agricultural Region
    NRM Regions 2017 (Qld 2019) Northern Agricultural Region
    Stubble practice - dominant (area) Stubble left intact
    Stubble practice - dominant (number) Stubble left intact
    Tillage practice - dominant (area) No cultivation
    Tillage practice - dominant (number) No cultivation
    Area management
    National Landcare Program Management Units 2018 Northern Agricultural Region
    Biodiversity
    Freshwater Ecoregions of the World Paleo
    IBRA 6 Regions Swan Coastal Plain
    IBRA 6 Sub Regions Perth
    IBRA 7 Regions Swan Coastal Plain
    IBRA 7 Subregions Perth
    Terrestrial Ecoregional Boundaries Swan Coastal Plain Scrub and Woodlands
    World Anthropogenic Biomes (2000) Remote rangelands
    Climate
    Agroclimatic classification of Australia "Mediterranean" climate, but with drier cooler winters and less growth than Classic "Mediterranean" climate
    Koppen Climate Classification (All Classes) Subtropical: distinctly dry summer
    Koppen Climate Classification (Major Classes) Subtropical
    Fire
    Fire regime niches Unclassified
    Hydrology
    Drainage Divisions Level 1 South West Coast
    Drainage Divisions Level 2 MOORE-HILL RIVERS
    River Regions MOORE-HILL RIVERS
    Land Management
    Western Australian Biodiversity Science Research Priority Regions South-West
    Marine
    Marine Ecoregions of the World Houtman
    States including coastal waters Western Australia (including Coastal Waters)
    Political
    ASGS Australian States and Territories Western Australia
    Australian States and Territories Western Australia
    Commonwealth Electoral Boundaries Durack
    Local Government Areas 2011 Dandaragan (S)
    Local Government Areas 2012 deprecated Dandaragan
    Local Government Areas PSMA 2018 SHIRE OF DANDARAGAN
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 24
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 583
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF WA
    PSMA ABS SA2 Statistical Areas (2016) GINGIN - DANDARAGAN
    PSMA ABS SA3 Statistical Areas (2016) WHEAT BELT - NORTH
    PSMA ABS SA4 Statistical Areas (2016) WESTERN AUSTRALIA - WHEAT BELT
    PSMA Commonwealth Electoral Boundaries (2016) DURACK
    PSMA Commonwealth Electoral Boundaries (2018) DURACK
    PSMA Indigenous Areas (2016) MOORA - CHITTERING
    PSMA Indigenous Locations (2016) GINGIN - DANDARAGAN - CHITTERING
    PSMA Indigenous Regions (2016) SOUTH-WESTERN WA
    PSMA Localities (2018) JURIEN BAY
    PSMA Remoteness Areas (2016) Outer Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (WA)
    PSMA State Electoral Boundaries (2016) AGRICULTURAL REGION
    PSMA State Electoral Boundaries (2018) MOORE, AG
    PSMA States (2016) WESTERN AUSTRALIA
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (WA)
    Statistical Local Areas Dandaragan (S)
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Perth Region
    Surface Geology of Australia Qdct
    Topography
    Physiographic Provinces of Australia Western Coastlands Province
    Physiographic Regions 2011 Swan Plain
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Other Shrublands
    NVIS 4.1 Major Vegetation Subgroups Other shrublands
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Residual
    Vegetation types - native Other forests and woodlands
    Vegetation types - present Other forests and woodlands

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 7168296.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.0277
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 2.7241
    Endemism 0.01582369
    Endemism (Non-marine) 0.01664698
    Mammals – Fritz et al 2009 - 0.5 degree 0.2564
    Migratory species (2008) 3.0 frequency
    Occurrence Density 2900.0 frequency
    Shannon Diversity (H) 5.403459 index
    Species Richness 786.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 2.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.4402207
    2030A1BMk35M: Evaporation - month min 78.1 mm
    2030A1BMk35M: Precipitation - annual mean 44.708332 mm
    2030A1BMk35M: Precipitation - driest month 6.66 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.69171685
    2030A1BMk35M: Precipitation - spring or autumn season -0.44036245
    2030A1BMk35M: Temperature - annual max mean 26.749166 degrees C
    2030A1BMk35M: Temperature - annual min mean 14.294167 degrees C
    2030A1BMk35M: Temperature - annual range 23.50998 degrees C
    Aridity index - annual mean 0.5280594
    Aridity index - month max 1.9502617
    Aridity index - month min 0.01997147
    Evaporation - annual mean 193.15814 (ml/5km x 5km pixel)
    Evaporation - average 14285.0 ml
    Evaporation - month max 350.5 mm
    Evaporation - month min 75.720184 mm
    Evaporation - variability 15.0 %
    Growth index C3 macrotherm plants - annual mean 0.07 index
    Growth index C3 mesotherm plants - annual mean 0.33 index
    Growth index C4 megatherm plants - annual mean 0.05 index
    Humidity - annual mean relative 73.58569 %
    Humidity - annual mean relative 3pm 65.54387 %
    Humidity - month max relative 85.118164 %
    Humidity - month max relative 3pm 73.28898 %
    Humidity - month min relative 58.170567 %
    Humidity - month min relative 3pm 58.170567 %
    Precipitation - annual 612.0 mm
    Precipitation - annual (Bio12) 576.0 mm
    Precipitation - annual mean 51.916668 mm
    Precipitation - annual seasonality -4.9444447
    Precipitation - coldest quarter (Bio19) 304.0 mm
    Precipitation - driest month 7.0 mm
    Precipitation - driest period (Bio14) 1.0 mm
    Precipitation - driest quarter (Bio17) 28.0 mm
    Precipitation - equinox seasonality ratio 0.6985294
    Precipitation - seasonality (Bio15) 87.0 mm
    Precipitation - spring or autumn season -0.42708334
    Precipitation - warmest quarter (Bio18) 33.0 mm
    Precipitation - wettest month 149.0 mm
    Precipitation - wettest period (Bio13) 28.0 mm
    Precipitation - wettest quarter (Bio16) 330.0 mm
    Radiation - annual mean (Bio20) 19.9 MJ/m2/day
    Radiation - seasonality (Bio23) 35.0
    Radiation - warmest quarter (Bio26) 26.1 MJ/m2/day
    Temperature - annual max mean 25.095833 degrees C
    Temperature - annual mean (Bio01) 19.5 degrees C
    Temperature - annual min mean 12.6258335 degrees C
    Temperature - annual range 23.399994 degrees C
    Temperature - annual range (Bio07) 23.7 degrees C
    Temperature - coldest month min 8.62 degrees C
    Temperature - coldest period min (Bio06) 9.1 degrees C
    Temperature - coldest quarter mean (Bio11) 14.7 degrees C
    Temperature - diurnal range mean (Bio02) 12.4 degrees C
    Temperature - driest quarter mean (Bio09) 24.2 degrees C
    Temperature - isothermality (Bio03) 0.52 %
    Temperature - month hottest maximum 32.0 degrees C
    Temperature - seasonality (Bio04) 1.37
    Temperature - warmest month min 17.86 degrees C
    Temperature - warmest period max (Bio05) 32.8 degrees C
    Temperature - warmest quarter (Bio10) 24.8 degrees C
    Temperature - wettest quarter mean (Bio08) 15.3 degrees C
    Wind run - annual mean 288.79315 km/day
    WorldClim: Precipitation - annual 552.0 mm
    WorldClim: Precipitation - coldest quarter 312.0 mm
    WorldClim: Precipitation - driest month 4.0 mm
    WorldClim: Precipitation - driest quarter 29.0 mm
    WorldClim: Precipitation - seasonality 84.0
    WorldClim: Precipitation - warmest quarter 33.0 mm
    WorldClim: Precipitation - wettest month 122.0 mm
    WorldClim: Precipitation - wettest quarter 312.0 mm
    WorldClim: Temperature - annual mean 191.0 degrees C * 10
    WorldClim: Temperature - annual range 232.0 degrees C * 10
    WorldClim: Temperature - coldest month min 90.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 145.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 123.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 221.0 degrees C * 10
    WorldClim: Temperature - isothermality 53.0 %
    WorldClim: Temperature - seasonality 3871.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 322.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 244.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 145.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.09219544 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.14317821 km
    Euclidean Distance to Coast (metres) 5154.128 m
    Remoteness index 6.5032687
    Hydrology
    Drainage - average 237.0 megalitres/5x5km/year
    Drainage - variability 198.0 %
    Runoff - average 36.0 megalitres/5x5km/year
    Water Observations From Space 0.37878788 Percentage
    Social
    Population - density SLA 2006 p/sqkm) 0.4 people/km^2
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 32.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.37 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 5.0 %
    Bulk density 1.6010747 Mg/m^3
    Carbon - organic 0.32096538 %
    Clay % 18.86916 %
    Hydrologic conductivity - average saturated 100.0 mm/h
    Moisture Index - annual mean (Bio28) 0.43
    Moisture Index - highest quarter mean (Bio32) 0.98
    Nutrient status 1.0 index
    Ph - soil 5.0 ph
    Soil depth 0.9 m
    Soil pedality 2.0
    Water holding capacity 22770.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 3.99636 Weathering Intensity Index
    Topography
    Aspect 253.0 degrees
    Averaged Topographic Relief 139.95833 metres
    Bathymetry and Elvation 9 sec 39.0 m
    Elevation 48.0 m
    Topographic Slope (degrees) 0.6632322 degrees
    Topographic relief 8.521524 m
    Topographic slope (%) 0.4835933 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.208 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 42.0 %
    Fractional Cover - Bare Soil (2012-03-05) 22.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 49.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 29.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0118 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.0 m^2 plant / m^2 ground
    NDVI Mean 52.0 NDVI x 100
    NPP Mean 6.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.3854 NDVI