We have just released new data filter features to improve the way you search and filter data in the ALA. There is now a default data filter in place that excludes lower quality records. You can pre-filter your search results using a suite of other data filters. To learn more, read Getting started with the data profiles.

Occurrence record: BOLD - Australian records - 3945788

GenomicDNA of LEPIDOPTERA | Moths recorded on 2010-11-12

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3945788
Other catalog numbers recordID:1821239;ProcessID:AMUB047-11;sampleID:BIOUG00796-D11
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector Mitchell, A. Andrew
Supplied as "Andrew Mitchell"
Reproductive condition sexual
Life stage adult
License CC-BY-Int
Field number BIOUG00796-D11
Occurrence status present
Abcd identification qualifier Not provided

Event

Field number BIOUG00796-D11
Occurrence date 2010-11-12
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type SCIENTIFIC

Geospatial

Country Australia
State or Territory New South Wales
Locality Gosford (C)
Latitude -33.512
Longitude 151.305
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession JN287335
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGAATTTGAGCAGGAATAGTAGGAACTTCATTAAGATTATTAATTCGTGCTGAATTAGGTAATCCAGGATCTTTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCACATGCTTTTATTATAATTTTTTTTATAGTAATACCAATTATAATTGGAGGATTTGGAAATTGATTAGTTCCTTTAATATTAGGGGCTCCCGATATAGCTTTCCCTCGAATGAATAATATAAGTTTTTGATTATTACCCCCATCTTTAACTTTATTAATTTCAAGAAGAATTGTAGAAAATGGAGCAGGAACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCTCATGGAGGAAGATCTGTAGATTTAGCTATTTTTTCCTTACATTTAGCAGGAATCTCTTCAATTTTAGGAGCTATTAATTTTATTACAACAATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCTGTAGGAATTACTGCATTTTTATTATTATTATCATTACCTGTTTTAGCAGGAGCTATTACTATACTTTTAACAGATCGTAATTTAAATACTTCTTTCTTTGACCCCGCTGGTGGTGGAGATCCCATCTTATATCAACATTTATTT
Owner institution code Australian Museum, Sydney
sequence last updated 2011-11-14T08:11:42Z

User flagged issues 

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) No cereal producers
    Fallow practice - dominant (number) No cereal producers
    GER Hunter Valley GER Hunter Valley
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Irrigation practice - dominant No irrigation
    Land use Nature conservation
    NRM Regions 2010 Hunter-Central Rivers
    NRM Regions 2014 Greater Sydney
    NRM Regions 2015 Greater Sydney
    NRM Regions 2017 Greater Sydney
    NRM Regions 2017 (Qld 2019) Greater Sydney
    Stubble practice - dominant (area) No cereal producers
    Stubble practice - dominant (number) No cereal producers
    Tillage practice - dominant (area) No cereal producers
    Tillage practice - dominant (number) No cereal producers
    Area management
    National Landcare Program Management Units 2018 Greater Sydney
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions Sydney Basin
    IBRA 6 Sub Regions Pittwater
    IBRA 7 Regions Sydney Basin
    IBRA 7 Subregions Pittwater
    Terrestrial Ecoregional Boundaries Eastern Australian Temperate Forests
    World Anthropogenic Biomes (2000) Urban
    Climate
    Agroclimatic classification of Australia Cooler end of the warm, wet sub-tropical climates��
    Koppen Climate Classification (All Classes) Temperate: no dry season (hot summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Eucalypt forest (temperate)
    Hydrology
    Drainage Divisions Level 1 South East Coast (NSW)
    Drainage Divisions Level 2 HAWKESBURY RIVER
    River Regions HAWKESBURY RIVER
    Marine
    Marine Ecoregions of the World Manning-Hawkesbury
    States including coastal waters New South Wales (including Coastal Waters)
    Political
    ASGS Australian States and Territories New South Wales
    Australian States and Territories New South Wales
    Commonwealth Electoral Boundaries Robertson
    Local Government Areas 2011 Gosford (C)
    Local Government Areas 2012 deprecated Gosford - West
    Local Government Areas PSMA 2018 CENTRAL COAST COUNCIL
    NSW Local Land Services Regions Greater Sydney
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 25
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 4743
    PSMA ABS Greater Capital City Statistical Areas (2016) GREATER SYDNEY
    PSMA ABS SA2 Statistical Areas (2016) UMINA - BOOKER BAY - PATONGA
    PSMA ABS SA3 Statistical Areas (2016) GOSFORD
    PSMA ABS SA4 Statistical Areas (2016) CENTRAL COAST
    PSMA Commonwealth Electoral Boundaries (2016) ROBERTSON
    PSMA Commonwealth Electoral Boundaries (2018) ROBERTSON
    PSMA Indigenous Areas (2016) GOSFORD
    PSMA Indigenous Locations (2016) GOSFORD - WEST
    PSMA Indigenous Regions (2016) NSW CENTRAL AND NORTH COAST
    PSMA Localities (2018) UMINA BEACH
    PSMA Remoteness Areas (2016) Major Cities of Australia
    PSMA Section of State (2016) MAJOR URBAN
    PSMA Section of State Range (2016) 250,000 TO 999,999
    PSMA Significant Urban Area (2016) CENTRAL COAST
    PSMA State Electoral Boundaries (2016) LEGISLATIVE COUNCIL
    PSMA State Electoral Boundaries (2018) LEGISLATIVE COUNCIL
    PSMA States (2016) NEW SOUTH WALES
    PSMA Urban Centre and Locality (2016) CENTRAL COAST
    Statistical Local Areas Gosford (C) - West
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Sydney Region
    Surface Geology of Australia -Rshw
    Topography
    Physiographic Provinces of Australia Macquarie Uplands Province
    Physiographic Regions 2011 Hawkesbury-Shoalhaven Plateaus
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Non forest
    Forests of Australia (2013) v2.0 Non Forest
    IGBP Land Cover vegetation classification scheme (2011) Urban and built-up
    Land cover Native shrublands and heathlands
    NVIS 4.1 Major Vegetation Groups Eucalypt Woodlands
    NVIS 4.1 Major Vegetation Subgroups Eucalyptus woodlands with a tussock grass understorey
    Tenure of Australia's forests (2013) v2.0 Private Freehold
    Vegetation - condition Residual
    Vegetation types - native Eucalypt open forests
    Vegetation types - present Eucalyptus open forest

    Environmental sampling for this location

    Area Management
    Natural resource management expenditure 8673855.0 $
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 1.3738
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 5.2691
    Endemism 0.02108329
    Endemism (Non-marine) 0.027830884
    Mammals – Fritz et al 2009 - 0.5 degree 0.6148
    Migratory species (2008) 5.0 frequency
    Occurrence Density 41894.0 frequency
    Shannon Diversity (H) 6.0929985 index
    Species Richness 3806.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 13.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 0.87556833
    2030A1BMk35M: Evaporation - month min 61.22 mm
    2030A1BMk35M: Precipitation - annual mean 98.0575 mm
    2030A1BMk35M: Precipitation - driest month 46.65 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.57323515
    2030A1BMk35M: Precipitation - spring or autumn season -0.7410857
    2030A1BMk35M: Temperature - annual max mean 23.944166 degrees C
    2030A1BMk35M: Temperature - annual min mean 13.798333 degrees C
    2030A1BMk35M: Temperature - annual range 20.779999 degrees C
    Aridity index - annual mean 0.92299306
    Aridity index - month max 2.0231001
    Aridity index - month min 0.45803344
    Evaporation - annual mean 127.118996 (ml/5km x 5km pixel)
    Evaporation - month max 202.89127 mm
    Evaporation - month min 62.298977 mm
    Growth index C3 macrotherm plants - annual mean 0.23 index
    Growth index C3 mesotherm plants - annual mean 0.6 index
    Growth index C4 megatherm plants - annual mean 0.16 index
    Humidity - annual mean relative 81.14504 %
    Humidity - annual mean relative 3pm 71.75663 %
    Humidity - month max relative 88.90404 %
    Humidity - month max relative 3pm 75.59322 %
    Humidity - month min relative 68.5987 %
    Humidity - month min relative 3pm 68.5987 %
    Precipitation - annual 1248.0 mm
    Precipitation - annual (Bio12) 1256.0 mm
    Precipitation - annual mean 102.34654 mm
    Precipitation - annual seasonality 0.12055636
    Precipitation - coldest quarter (Bio19) 260.0 mm
    Precipitation - driest month 65.0 mm
    Precipitation - driest period (Bio14) 14.0 mm
    Precipitation - driest quarter (Bio17) 206.0 mm
    Precipitation - equinox seasonality ratio 0.6022002
    Precipitation - seasonality (Bio15) 29.0 mm
    Precipitation - spring or autumn season -0.6576809
    Precipitation - warmest quarter (Bio18) 386.0 mm
    Precipitation - wettest month 140.03706 mm
    Precipitation - wettest period (Bio13) 39.0 mm
    Precipitation - wettest quarter (Bio16) 431.0 mm
    Radiation - annual mean (Bio20) 16.3 MJ/m2/day
    Radiation - seasonality (Bio23) 34.0
    Radiation - warmest quarter (Bio26) 21.2 MJ/m2/day
    Temperature - annual max mean 21.944166 degrees C
    Temperature - annual mean (Bio01) 17.6 degrees C
    Temperature - annual min mean 11.519167 degrees C
    Temperature - annual range 21.606903 degrees C
    Temperature - annual range (Bio07) 20.7 degrees C
    Temperature - coldest month min 5.36 degrees C
    Temperature - coldest period min (Bio06) 6.6 degrees C
    Temperature - coldest quarter mean (Bio11) 12.7 degrees C
    Temperature - diurnal range mean (Bio02) 10.0 degrees C
    Temperature - driest quarter mean (Bio09) 13.9 degrees C
    Temperature - isothermality (Bio03) 0.48 %
    Temperature - month hottest maximum 26.38 degrees C
    Temperature - seasonality (Bio04) 1.28
    Temperature - warmest month min 17.19 degrees C
    Temperature - warmest period max (Bio05) 27.3 degrees C
    Temperature - warmest quarter (Bio10) 22.2 degrees C
    Temperature - wettest quarter mean (Bio08) 21.0 degrees C
    Wind run - annual mean 277.16437 km/day
    WorldClim: Precipitation - annual 1279.0 mm
    WorldClim: Precipitation - coldest quarter 270.0 mm
    WorldClim: Precipitation - driest month 61.0 mm
    WorldClim: Precipitation - driest quarter 205.0 mm
    WorldClim: Precipitation - seasonality 29.0
    WorldClim: Precipitation - warmest quarter 395.0 mm
    WorldClim: Precipitation - wettest month 161.0 mm
    WorldClim: Precipitation - wettest quarter 445.0 mm
    WorldClim: Temperature - annual mean 175.0 degrees C * 10
    WorldClim: Temperature - annual range 207.0 degrees C * 10
    WorldClim: Temperature - coldest month min 61.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 123.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 101.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 131.0 degrees C * 10
    WorldClim: Temperature - isothermality 48.0 %
    WorldClim: Temperature - seasonality 3826.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 268.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 221.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 220.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.01 degrees
    Distance - to coast 0.01414214 km x 100
    Distance - to non-permanent water (weighted) 0.089999996 degrees
    Distance - to permanent water (weighted) 0.01 km
    Euclidean Distance to Coast (metres) 5979.111 m
    Remoteness index 0.1
    Hydrology
    Water Observations From Space 0.0 Percentage
    Substrate
    2030A1BMk35M: Water stress index - month max 81.0
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 47.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.5 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 20.0 %
    Bulk density 1.3318447 Mg/m^3
    Carbon - organic -241.41376 %
    Clay % 17.031553 %
    Hydrologic conductivity - average saturated 55.454544 mm/h
    Moisture Index - annual mean (Bio28) 0.85
    Moisture Index - highest quarter mean (Bio32) 1.0
    Nutrient status 1.0 index
    Soil depth 1.1 m
    Soil pedality 1.8737864
    Water holding capacity 54000.0 mm
    Water stress index - month max 81.0
    Weathering Intensity V2 1.86455 Weathering Intensity Index
    Topography
    Aspect 67.0 degrees
    Averaged Topographic Relief 196.75 metres
    Bathymetry and Elvation 9 sec 72.0 m
    Elevation 22.0 m
    Topographic Slope (degrees) 11.709343 degrees
    Topographic relief 103.7709 m
    Topographic slope (%) 7.525234 %
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.3469 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 63.0 %
    Fractional Cover - Bare Soil (2012-03-05) 44.0 % Bare Soil
    Fractional Cover - Non-persistent Vegetation (2012-03-05) 0.0 % Non-persistent Vegetation
    Fractional Cover - Persistent Vegetation (2012-03-05) 56.0 % Persistent Vegetation
    Gross Primary Productivity (2012-03-13) 0.0386 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 1.8 m^2 plant / m^2 ground
    NPP Mean 10.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.7006 NDVI