Occurrence record: BOLD - Australian records - 3604212

GenomicDNA of LEPIDOPTERA | Moths recorded on 2006-01-04

Dataset

Data partner Barcode of Life
Data resource BOLD - Australian records
Catalog number 3604212
Other catalog numbers recordID:1418418;ProcessID:GWORY662-10;sampleID:BC EF Lep 00195
Basis of record GenomicDNA
Supplied basis "Genomic DNA"
Collector/Observer Friedrich, E.
Supplied as "E. Friedrich"
Reproductive condition sexual
Sex male
Life stage adult
License CC-BY-Int
Field number BC EF Lep 00195
Occurrence status present
Abcd identification qualifier Not provided
Identification ID Egbert Friedrich

Event

Field number BC EF Lep 00195
Record date 2006-01-04
Date precision Day

Taxonomy

Scientific name LEPIDOPTERA
Taxon rank order
Common name Moths
Kingdom Animalia
Phylum Arthropoda
Class Insecta
Order Lepidoptera
Taxonomic issue No issues
Name match metric Exact match
The supplied name matched the name exactly.
Name parse type wellformed

Geospatial

Country Australia
State / Province Queensland
Locality Scenic Rim (R)
Locality Green Mountain, Duck Creek Rd.
Latitude -28.2017
Longitude 153.103
Geodetic datum EPSG:4326
Coordinate precision Unknown
Biome Terrestrial

Additional properties

genbank accession HM913737
markercode COI-5P
nucleotides AACATTATATTTTATTTTTGGTATTTGAGCAGGAATAGTTGGAACTTCTTTAAGTCTTCTTATTCGAGCTGAATTAGGAAATCCAGGATCATTAATTGGAGATGATCAAATTTATAATACTATTGTTACAGCTCATGCTTTTATTATAATTTTTTTTATAGTTATACCTATTATAATCGGAGGTTTTGGAAATTGACTAGTACCCTTAATATTAGGAGCTCCTGATATAGCATTCCCTCGAATAAATAATATAAGTTTTTGACTTTTACCCCCGTCGCTTACTTTATTAATTTCAAGAAGAATTGTTGAAAATGGTGCAGGGACAGGATGAACAGTTTACCCCCCACTTTCATCTAATATTGCCCATGGAGGTAGTTCTGTAGATTTAGCAATTTTTTCCTTACATTTAGCAGGAATTTCTTCAATTTTAGGAGCTATTAATTTTATTACTACTATTATTAATATACGATTAAATAATTTATCTTTTGATCAAATACCTTTATTTGTTTGAGCAGTAGGTATTACTGCTTTCTTATTATTATTATCTTTACCTGTATTAGCAGGAGCAATTACAATATTATTAACAGATCGTAATTTAAATACTTCATTCTTTGATCCAGCTGGAGGTGGAGACCCTATTCTATATCAACATTTATTT
Owner institution code Research Collection of Egbert Friedrich
sequence last updated 2011-11-14T08:11:20Z

User flagged issues 

User Assertion Status:

    Data quality tests

    Test name Result
    Occurrence status assumed to be present Warning
    Geodetic datum assumed WGS84 Warning
    Basis of record not supplied Passed
    Basis of record badly formed Passed
    Invalid collection date Passed
    Incomplete collection date Passed
    First of the month Passed
    Collector name unparseable Passed
    Missing catalogue number Passed
    Data are generalised Passed
    Name not recognised Passed
    Invalid scientific name Passed
    Name not in national checklists Passed
    Decimal coordinates not supplied Passed
    Coordinates are transposed Passed
    Coordinates are out of range for species Passed
    Supplied coordinates are zero Passed
    Zero latitude Passed
    Zero longitude Passed
    Supplied country not recognised Passed
    Location not supplied Passed
    Country inferred from coordinates Passed
    Supplied coordinates centre of state Passed
    Coordinates centre of country Passed
    Missing geodetic datum Passed
    Coordinates dont match supplied state Passed
    Show/Hide 13 missing properties
    Show/Hide 47 tests that have not been run

    Additional political boundaries information

    Area Management
    Fallow practice - dominant (area) Fallow 3-9 months
    Fallow practice - dominant (number) Equal 3-9 and greater than 9 months
    GER Border Ranges GER Border Ranges
    GER National Corridor GER National Corridor
    GER Standard Boundary GER Standard Boundary
    Global 200 priority ecoregions - Freshwater Eastern Australia Rivers & Streams
    Global 200 priority ecoregions - Terrestrial Eastern Asutralia Temperate Forests
    Great Eastern Ranges Initiative GER Great Eastern Ranges Initiative
    Important Bird Areas (IBA) Australia Scenic Rim IBA
    Irrigation practice - dominant 6. Local knowledge
    Land use Urban intensive uses
    NRM Regions 2010 South East Queensland
    NRM Regions 2014 South East Queensland
    NRM Regions 2015 South East Queensland
    NRM Regions 2017 South East Queensland
    NRM Regions 2017 (Qld 2019) South East Queensland
    Stubble practice - dominant (area) Stubble ploughed in
    Stubble practice - dominant (number) Stubble ploughed in
    Tillage practice - dominant (area) Other cultivation
    Tillage practice - dominant (number) Other cultivation
    Area management
    National Landcare Program Management Units 2018 South East Queensland
    Biodiversity
    Freshwater Ecoregions of the World Eastern Coastal Australia
    IBRA 6 Regions South Eastern Queensland
    IBRA 6 Sub Regions Richmond - Tweed, Scenic Rim
    IBRA 7 Regions South Eastern Queensland
    IBRA 7 Subregions Scenic Rim
    Terrestrial Ecoregional Boundaries Eastern Australian Temperate Forests
    World Anthropogenic Biomes (2000) Remote woodlands
    Climate
    Agroclimatic classification of Australia Warmer and wetter end of the warm, wet sub-tropical climates
    Koppen Climate Classification (All Classes) Temperate: no dry season (warm summer)
    Koppen Climate Classification (Major Classes) Temperate
    Fire
    Fire regime niches Rainforest (tropical)
    Hydrology
    Drainage Divisions Level 1 North East Coast
    Drainage Divisions Level 2 LOGAN-ALBERT RIVERS
    River Regions LOGAN-ALBERT RIVERS
    Marine
    Marine Ecoregions of the World Tweed-Moreton
    States including coastal waters Queensland (including Coastal Waters)
    Political
    ASGS Australian States and Territories Queensland
    Australian States and Territories Queensland
    Commonwealth Electoral Boundaries Wright
    Local Government Areas 2011 Scenic Rim (R)
    Local Government Areas 2012 deprecated Beaudesert - Pt B
    Local Government Areas PSMA 2018 SCENIC RIM REGIONAL
    PSMA ABS Census Indigenous Language Speakers by Area - I01B (2016) 30
    PSMA ABS Census Selected Person Characteristics by Indigenous Status by Area - I01A (2016) 1225
    PSMA ABS Greater Capital City Statistical Areas (2016) REST OF QLD
    PSMA ABS SA2 Statistical Areas (2016) TAMBORINE - CANUNGRA
    PSMA ABS SA3 Statistical Areas (2016) GOLD COAST HINTERLAND
    PSMA ABS SA4 Statistical Areas (2016) GOLD COAST
    PSMA Commonwealth Electoral Boundaries (2016) WRIGHT
    PSMA Commonwealth Electoral Boundaries (2018) WRIGHT
    PSMA Indigenous Areas (2016) BEAUDESERT - BOONAH
    PSMA Indigenous Locations (2016) BEAUDESERT - BOONAH
    PSMA Indigenous Regions (2016) BRISBANE
    PSMA Localities (2018) O'REILLY
    PSMA Remoteness Areas (2016) Inner Regional Australia
    PSMA Section of State (2016) RURAL BALANCE
    PSMA Section of State Range (2016) REMAINDER OF STATE/TERRITORY
    PSMA Significant Urban Area (2016) NOT IN ANY SIGNIFICANT URBAN AREA (QLD)
    PSMA State Electoral Boundaries (2016) BEAUDESERT
    PSMA State Electoral Boundaries (2018) SCENIC RIM
    PSMA States (2016) QUEENSLAND
    PSMA Urban Centre and Locality (2016) REMAINDER OF STATE/TERRITORY (QLD)
    Statistical Local Areas Scenic Rim (R) - Tamborine-Canungra
    World Country Boundaries Australia
    Substrate
    Geological Regions of Australia Clarence-Moreton Region
    Surface Geology of Australia Czbl
    Topography
    Physiographic Provinces of Australia New England-Moreton Uplands Province
    Physiographic Regions 2011 Toowoomba Plateau
    Vegetation
    Australia's Indigenous forest estate (2013) v2.0 Non-Indigenous, Native forest
    Forests of Australia (2013) v2.0 Rainforest
    Land cover Native forests and woodlands
    NVIS 4.1 Major Vegetation Groups Rainforests and Vine Thickets
    NVIS 4.1 Major Vegetation Subgroups Tropical or sub-tropical rainforest
    Tenure of Australia's forests (2013) v2.0 Nature Conservation Reserve
    Vegetation - condition Residual
    Vegetation types - native Eucalypt woodlands
    Vegetation types - present Eucalyptus woodlands

    Environmental sampling for this location

    Area Management
    Beef numbers 82783.0 dse
    Dairy numbers 58115.0 dse
    Natural resource management expenditure 7605171.0 $
    Natural resource management expenditure - additional 2.0 $/ha
    Sheep numbers 60.0 dse
    Biodiversity
    Acacia – Miller et al 2012 - 0.5 degree 0.8934
    Amphibians (global) – Pyron & Wiens 2011 - 0.5 degree 4.9798
    Endemism 0.079837315
    Endemism (Non-marine) 0.08502086
    Mammals – Fritz et al 2009 - 0.5 degree 0.6191
    Migratory species (2008) 7.0 frequency
    Occurrence Density 99325.0 frequency
    Shannon Diversity (H) 5.3099933 index
    Species Richness 3828.0 frequency
    Threatened communities (2008) 0.0 frequency
    Threatened species (2008) 16.0 frequency
    Climate
    2030A1BMk35M: Aridity index - annual mean 1.2730834
    2030A1BMk35M: Aridity index - month max 2.4343204
    2030A1BMk35M: Aridity index - month min 0.36611605
    2030A1BMk35M: Evaporation - annual mean 115.88292 mm
    2030A1BMk35M: Evaporation - month max 171.95 mm
    2030A1BMk35M: Evaporation - month min 58.22 mm
    2030A1BMk35M: Growth index C3 macrotherm plants - annual mean 0.33 index
    2030A1BMk35M: Growth index C3 mesotherm plants - annual mean 0.75 index
    2030A1BMk35M: Growth index C4 megatherm plants - annual mean 0.24 index
    2030A1BMk35M: Humidity - annual mean relative 3pm 78.78359 %
    2030A1BMk35M: Humidity - month max relative 3pm 84.21357 %
    2030A1BMk35M: Humidity - month min relative 3pm 74.283394 %
    2030A1BMk35M: Precipitation - annual mean 142.54584 mm
    2030A1BMk35M: Precipitation - driest month 43.22 mm
    2030A1BMk35M: Precipitation - equinox seasonality ratio 0.537143
    2030A1BMk35M: Precipitation - max difference between successive months 2.215458 mm/day
    2030A1BMk35M: Precipitation - min difference between successive months -2.3266127 mm/day
    2030A1BMk35M: Precipitation - solstice seasonality ratio 3.2767584
    2030A1BMk35M: Precipitation - spring or autumn season -0.8587132
    2030A1BMk35M: Precipitation - summer or winter season 2.2658489
    2030A1BMk35M: Precipitation - wettest month 261.33 mm
    2030A1BMk35M: Precipitation deficit - annual mean 26.662914 mm
    2030A1BMk35M: Precipitation deficit - month max -74.83 mm
    2030A1BMk35M: Precipitation deficit - month min 125.499985 mm
    2030A1BMk35M: Radiation - max month precipitation modified 22.21 MJ/m2/day
    2030A1BMk35M: Radiation - mean annual precipitation modified 16.756666 MJ/m2/day
    2030A1BMk35M: Radiation - min month precipitation modified 10.72 MJ/m2/day
    2030A1BMk35M: Temperature - annual max mean 22.215 degrees C
    2030A1BMk35M: Temperature - annual min mean 12.818334 degrees C
    2030A1BMk35M: Temperature - annual range 18.610016 degrees C
    2030A1BMk35M: Temperature - coldest month min 7.71 degrees C
    2030A1BMk35M: Temperature - coolest month max 16.8 degrees C
    2030A1BMk35M: Temperature - max difference in max 2.7999878 degrees C/day
    2030A1BMk35M: Temperature - max difference in min 2.3900146 degrees C/day
    2030A1BMk35M: Temperature - max month diurnal range 11.029999 degrees C
    2030A1BMk35M: Temperature - mean annual diurnal range 9.39667 degrees C
    2030A1BMk35M: Temperature - min difference in max -2.8200073 degrees C/day
    2030A1BMk35M: Temperature - min difference in min -2.5700073 degrees C/day
    2030A1BMk35M: Temperature - min month diurnal range 8.160004 degrees C
    2030A1BMk35M: Temperature - month hottest maximum 26.32 degrees C
    2030A1BMk35M: Temperature - warmest month min 17.24 degrees C
    Aridity index - annual mean 1.388153
    Aridity index - month max 2.2671928
    Aridity index - month min 0.54423815
    Evaporation - annual mean 106.523926 (ml/5km x 5km pixel)
    Evaporation - average 23686.0 ml
    Evaporation - month max 166.57388 mm
    Evaporation - month min 53.38646 mm
    Evaporation - variability 10.0 %
    Growth index C3 macrotherm plants - annual mean 0.23 index
    Growth index C3 mesotherm plants - annual mean 0.7 index
    Growth index C4 megatherm plants - annual mean 0.16 index
    Humidity - annual mean relative 84.44356 %
    Humidity - annual mean relative 3pm 77.41094 %
    Humidity - month max relative 90.62426 %
    Humidity - month max relative 3pm 82.95221 %
    Humidity - month min relative 72.842575 %
    Humidity - month min relative 3pm 72.842575 %
    Precipitation - annual 1055.0 mm
    Precipitation - annual (Bio12) 1811.0 mm
    Precipitation - annual (log) seasonality index 0.10009158
    Precipitation - annual mean 140.63434 mm
    Precipitation - annual seasonality 0.89196354
    Precipitation - annual seasonality ratio 1.8934929
    Precipitation - autumn 377.0 mm
    Precipitation - autumn reliability 35.0 %
    Precipitation - coldest quarter (Bio19) 242.0 mm
    Precipitation - driest month 57.56288 mm
    Precipitation - driest period (Bio14) 10.0 mm
    Precipitation - driest quarter (Bio17) 184.0 mm
    Precipitation - equinox seasonality ratio 0.69662625
    Precipitation - max difference between successive months 1.7768141 mm/day
    Precipitation - min difference between successive months -2.2059286 mm/day
    Precipitation - seasonality (Bio15) 49.0 mm
    Precipitation - solstice seasonality ratio 2.2977765
    Precipitation - spring 270.0 mm
    Precipitation - spring or autumn (log) season -0.06292451
    Precipitation - spring or autumn season -0.43407512
    Precipitation - spring reliability 45.0 %
    Precipitation - summer 583.0 mm
    Precipitation - summer or winter (log) season 0.14672542
    Precipitation - summer or winter season 1.2932416
    Precipitation - summer reliability 53.0 %
    Precipitation - warmest quarter (Bio18) 713.0 mm
    Precipitation - wettest month 244.4671 mm
    Precipitation - wettest period (Bio13) 73.0 mm
    Precipitation - wettest quarter (Bio16) 726.0 mm
    Precipitation - winter 239.0 mm
    Precipitation - winter reliability 25.0 %
    Precipitation deficit - annual mean 34.11042 mm
    Precipitation deficit - month max -48.20494 mm
    Precipitation deficit - month min 123.536934 mm
    Radiation - annual mean (Bio20) 16.6 MJ/m2/day
    Radiation - coldest quarter (Bio27) 12.2 MJ/m2/day
    Radiation - driest quarter (Bio25) 15.6 MJ/m2/day
    Radiation - highest period (Bio21) 22.4 MJ/m2/day
    Radiation - lowest period (Bio22) 10.1 MJ/m2/day
    Radiation - max month precipitation modified 22.4 MJ/m2/day
    Radiation - mean annual precipitation modified 16.704815 MJ/m2/day
    Radiation - min month precipitation modified 10.5 MJ/m2/day
    Radiation - seasonality (Bio23) 24.0
    Radiation - warmest quarter (Bio26) 20.0 MJ/m2/day
    Radiation - wettest quarter (Bio24) 19.3 MJ/m2/day
    Temperature - annual max mean 20.343334 degrees C
    Temperature - annual mean (Bio01) 16.4 degrees C
    Temperature - annual min mean 10.900833 degrees C
    Temperature - annual range 20.052551 degrees C
    Temperature - annual range (Bio07) 18.8 degrees C
    Temperature - coldest month min 5.65 degrees C
    Temperature - coldest period min (Bio06) 6.6 degrees C
    Temperature - coldest quarter mean (Bio11) 11.7 degrees C
    Temperature - coolest month max 14.94 degrees C
    Temperature - diurnal range mean (Bio02) 9.2 degrees C
    Temperature - driest quarter mean (Bio09) 13.0 degrees C
    Temperature - isothermality (Bio03) 0.49 %
    Temperature - max absolute mean max 37.0 degrees C
    Temperature - max difference in max 2.5799866 degrees C/day
    Temperature - max difference in min 2.5299988 degrees C/day
    Temperature - max month diurnal range 10.670013 degrees C
    Temperature - mean annual absolute mean min 0.34901467 degrees C
    Temperature - mean annual diurnal range 9.442502 degrees C
    Temperature - min absolute mean min -4.04096 degrees C
    Temperature - min difference in max -3.0499878 degrees C/day
    Temperature - min difference in min -3.0500183 degrees C/day
    Temperature - min month diurnal range 8.160004 degrees C
    Temperature - month hottest maximum 24.84 degrees C
    Temperature - month mean absolute max 30.395912 degrees C
    Temperature - seasonality (Bio04) 1.17
    Temperature - warmest month min 15.48 degrees C
    Temperature - warmest period max (Bio05) 25.3 degrees C
    Temperature - warmest quarter (Bio10) 20.4 degrees C
    Temperature - wettest quarter mean (Bio08) 20.3 degrees C
    Vapour pressure deficit - annual mean 0.1772049 KPa
    Vapour pressure deficit - annual mean 9am 0.2591134 KPa
    Vapour pressure deficit - month max 0.4055978 KPa
    Vapour pressure deficit - month max 9am 0.4055978 KPa
    Vapour pressure deficit - month min 0.08167553 KPa
    Vapour pressure deficit - month min 9am 0.14894521 KPa
    Wind run - annual mean 151.38242 km/day
    Wind run - month max 176.83652 km/day
    Wind run - month min 130.52426 km/day
    Wind speed - annual mean 3pm 3.617577 m/s
    Wind speed - annual mean 9am 2.176692 m/s
    Wind speed - annual mean 9am or 3pm 3.3076093 m/s
    Wind speed - month max 3pm 4.1 m/s
    Wind speed - month max 9am 2.5152187 m/s
    Wind speed - month max 9am or 3pm 4.1 m/s
    Wind speed - month min 3pm 3.1 m/s
    Wind speed - month min 9am 1.8 m/s
    Wind speed - month min 9am or 3pm 1.8 m/s
    WorldClim: Precipitation - annual 1703.0 mm
    WorldClim: Precipitation - coldest quarter 270.0 mm
    WorldClim: Precipitation - driest month 50.0 mm
    WorldClim: Precipitation - driest quarter 212.0 mm
    WorldClim: Precipitation - seasonality 41.0
    WorldClim: Precipitation - warmest quarter 647.0 mm
    WorldClim: Precipitation - wettest month 240.0 mm
    WorldClim: Precipitation - wettest quarter 672.0 mm
    WorldClim: Temperature - annual mean 156.0 degrees C * 10
    WorldClim: Temperature - annual range 189.0 degrees C * 10
    WorldClim: Temperature - coldest month min 56.0 degrees C * 10
    WorldClim: Temperature - coldest quarter mean 107.0 degrees C * 10
    WorldClim: Temperature - diurnal range mean 95.0 degrees C * 10
    WorldClim: Temperature - driest quarter mean 114.0 degrees C * 10
    WorldClim: Temperature - isothermality 50.0 %
    WorldClim: Temperature - seasonality 3542.0 standard deviation (degrees C * 10) * 100
    WorldClim: Temperature - warmest month max 245.0 degrees C * 10
    WorldClim: Temperature - warmest quarter mean 197.0 degrees C * 10
    WorldClim: Temperature - wettest quarter mean 195.0 degrees C * 10
    Distance
    Distance - to any water (weighted) 0.0 degrees
    Distance - to coast 0.3640055 km x 100
    Distance - to non-permanent water (weighted) 0.0 degrees
    Distance - to permanent water (weighted) 0.042426407 km
    Euclidean Distance to Coast (metres) 29892.76 m
    Remoteness index 2.8017526
    Hydrology
    Drainage - average 1016.0 megalitres/5x5km/year
    Drainage - variability 156.0 %
    Runoff - average 4815.0 megalitres/5x5km/year
    Water Observations From Space 0.0 Percentage
    Marine
    Great Barrier Reef 100m DEM 820.94 m
    Social
    Age 42.416065 years
    Age - prime group 24.234062 Count
    Disadvantaged 995.734 points (mean=1000)
    Education - degrees 14.859646 %
    Education - vocational training 28.695892 %
    Employment 4.472232 %
    Home ownership 74.1779 %
    Income - high 29.88445 %
    Income - low 13.952054 %
    Internet 66.55335 %
    Population - change 20.805407 count
    Population - density SLA 2006 p/sqkm) 20.637285 people/km^2
    Unemployment rate 2.6931877 %
    Work force - older 31.020697 Count
    Substrate
    2030A1BMk35M: Crop factor - annual mean 0.89995813
    2030A1BMk35M: Crop factor - month max 0.9
    2030A1BMk35M: Crop factor - month min 0.89949805
    2030A1BMk35M: Water deficit - month max 0.0 mm
    2030A1BMk35M: Water deficit - month mean 0.0 mm
    2030A1BMk35M: Water deficit - month min 0.0 mm
    2030A1BMk35M: Water potential - annual mean -0.09468864 MPa
    2030A1BMk35M: Water potential - month max -2.8643754E-14 MPa
    2030A1BMk35M: Water potential - month min -0.40347084 MPa
    2030A1BMk35M: Water stress index - annual mean 80.99623
    2030A1BMk35M: Water stress index - month max 81.0
    2030A1BMk35M: Water stress index - month min 80.95483
    2030A1BMk35M: Water surplus - annual mean 38.257034 mm
    2030A1BMk35M: Water surplus - month max 135.09338 mm
    2030A1BMk35M: Water surplus - month min 0.0 mm
    ASRIS 0-1m Plant Available Water Capacity (250m raster) 105.0 mm
    ASRIS 0-30cm Bulk Density (250m raster) 1.06 Mg/m3
    ASRIS 0-30cm Clay Content (250m raster) 39.0 %
    Bouguer gravity anomalies 90.60725 Gal
    Bulk density 1.1880062 Mg/m^3
    Calcrete 0.0 presence
    Carbon - organic 2.7217462 %
    Carbon store pre-European 457.981 kgC/ha
    Clay % 50.444786 %
    Crop factor - annual mean 0.9
    Crop factor - month max 0.9
    Crop factor - month min 0.8999999
    Erodibility 26.0 k factor
    Erosional surfaces - proportion 100.0 %
    Erosivity 5851.0 MJ mm/ha/hr
    Hydrologic conductivity - average saturated 130.76923 mm/h
    Hydrological conductivity - uncertainty 10.0
    Lithology - age range 7.06 my
    Lithology - fertility 6.0 index
    Lithology - mean age 19.5 my
    Lithology - mean age (log) 1.2900347 log my
    Lithology - mean age range (log) 0.8488047 log my
    Magnetic anomalies 50.0 nT
    Moisture - average 54.0 %
    Moisture - variability 10.0 %
    Moisture Index - annual mean (Bio28) 0.97
    Moisture Index - coldest quarter mean (Bio35) 1.0
    Moisture Index - highest period (Bio29) 1.0
    Moisture Index - highest quarter mean (Bio32) 1.0
    Moisture Index - lowest period (Bio30) 0.84
    Moisture Index - lowest quarter mean (Bio33) 0.9
    Moisture Index - seasonality (Bio31) 5.0
    Moisture Index - warmest quarter mean (Bio34) 0.99
    Nitrogen - plant-available pre-European 39093.48 kgN/ha
    Nitrogen concentration pre-European 70.59803 mgN kg/H2O
    Nitrogen store pre-European 312.9089 kgN/ha
    Nutrient status 2.2 index
    Pedality hydrological score 3.6068506
    Ph - soil 4.0 ph
    Phosphorus - plant-available pre-European 57.67593 kgP/ha
    Phosphorus - plant-available total pre-European 3936.493 kgP/ha
    Phosphorus pre-European 13.01275 mgP kg/H2O
    Soil depth 1.2 m
    Soil pedality 3.6068506
    Soils - coarse 0.0 class
    Substrate data reliability 2.0
    Topographic wetness index 0.7879251
    Unreliable water retention parameters 0.0
    Water deficit - month max 0.0 mm
    Water deficit - month mean 0.0 mm
    Water deficit - month min 0.0 mm
    Water holding capacity 42000.0 mm
    Water holding capacity - plant-available 196.0 mm
    Water potential - annual mean -0.015645947 MPa
    Water potential - month max -2.8643754E-14 MPa
    Water potential - month min -0.06484992 MPa
    Water stress index - annual mean 81.0
    Water stress index - month max 81.0
    Water stress index - month min 80.99999
    Water surplus - annual mean 44.762817 mm
    Water surplus - month max 135.62994 mm
    Water surplus - month min 0.0 mm
    Weathering Intensity V2 0.111 Weathering Intensity Index
    Topography
    Aspect 336.0 degrees
    Averaged Topographic Relief 616.25 metres
    Bathymetry and Topography 9 sec 772.0 m
    Elevation 698.0 m
    Ridge top flatness 0.0
    Ridge top flatness - proportion 0.0 %
    Slope length 1000.0 m
    Topographic Slope (degrees) 18.9042 degrees
    Topographic relief 318.5166 m
    Topographic roughness 13.52024 %
    Topographic slope (%) 17.60655 %
    Valley bottom % 0.0 %
    Valley bottom flatness index 0.0
    Vegetation
    Enhanced Vegetation Index (2012-03-05) 0.4666 EVI
    Fraction of Photosynthetically Active Radiation (fPAR) 92.0 %
    Gross Primary Productivity (2012-03-13) 0.0144 kg C/m^2
    Leaf Area Index (LAI) - 2012-03-05 6.1 m^2 plant / m^2 ground
    NDVI Mean 87.0 NDVI x 100
    NPP Mean 19.0 tonnes/ha/yr
    Normalized Difference Vegetation Index (2012-03-05) 0.865 NDVI
    Phenology peak day of year 2002 dry 96.44827 Day
    Phenology peak day of year 2012 wet 8.466666 Day