Occurrence record: PID441

Material Sample of SESSILIA recorded on 2014-05-01
   API

Dataset

Data resource DNA metabarcoding assays reveal a diverse prey assemblage for Mobula rays in the Bohol Sea, Philippines
Occurrence ID PID441
Record type Material Sample
Supplied basis "MaterialSample"
License CC-BY 3.0 (Au)
Associated occurrences source specimen
Related resource id Mb13
Associated references https://onlinelibrary.wiley.com/doi/full/10.1002/ece3.4858
Presence/Absence PRESENT
Supplied as present

Event

Occurrence date 2014-05-01
Date precision DAY

Taxonomy

Scientific name SESSILIA
Identified to rank order
Kingdom Animalia
Phylum Arthropoda
Class Maxillopoda
Order Sessilia
Name match metric exactMatch
Name parse type SCIENTIFIC

Geospatial

Country Philippines
Latitude 9.430907
Supplied as: "9.430906655"
Longitude 124.806699
Supplied as: "124.8066991"
Datum EPSG:4326
Coordinate precision Unknown
Coordinate uncertainty (in metres) 37240.69
Terrestrial false
Biome MARINE
Marine true
Country Code PH
Footprint well known text polygon(124.8 9.6,125.1 9.6, 125 9.42, 124.9 9.41,124.84 9.3,124.9 9.25,124.83 9.15,124.75 9.3, 124.5 9.3,124.65 9.5,124.8 9.6)

Additional properties

primers 18S Universal
reads 5
reference Figure 2i
sequence TAAAGATTAAGCCATGCATGTATCAGTACAAGCCAAACTAAGGTGAAACCGCGAATGGCTCATTAAATCAGTTATTATTTACTGGCCGAGACAGTGATACATGGATAACTGTGGTAATTCTAGAGCTAATACATGCAACCGAGCCCCAGTCCTGGCTCTCGGGCCAGGCGGGGCGCTTTTATTGGCTGAAAACCGATGATCGCCCTCGTGGCGGTCGTTATTCGATGAATCACAATAACATTGTGTGGATCGTAT
data type comment You are viewing a record derived from DNA analysis, if you want further info on this type of occurrence record please go to this page: https://www.ala.org.au/environmentaldna/

User flagged issues 

    Data quality tests

    Test name Result
    Coordinate rounded Warning
    Country inferred from coordinates Warning
    First of the month Warning
    Footprint WKT invalid Warning
    Geodetic datum assumed WGS84 Warning
    Show/Hide 72 passed properties
    Show/Hide 7 missing properties
    Show/Hide 30 tests that have not been run